Incidental Mutation 'R3744:Tcte1'
ID271143
Institutional Source Beutler Lab
Gene Symbol Tcte1
Ensembl Gene ENSMUSG00000023949
Gene Namet-complex-associated testis expressed 1
SynonymsTcte-1, D17Sil1
MMRRC Submission 040730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R3744 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location45523434-45542679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45539671 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 291 (D291G)
Ref Sequence ENSEMBL: ENSMUSP00000109175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113547] [ENSMUST00000180252]
Predicted Effect probably damaging
Transcript: ENSMUST00000113547
AA Change: D291G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109175
Gene: ENSMUSG00000023949
AA Change: D291G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
Blast:LRR 235 274 7e-14 BLAST
LRR 304 331 5.02e-6 SMART
LRR 332 358 1.28e-3 SMART
LRR 359 386 5.81e-2 SMART
LRR 387 414 2.05e-2 SMART
LRR 415 442 1.13e-4 SMART
Blast:LRR 443 470 3e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180252
SMART Domains Protein: ENSMUSP00000136337
Gene: ENSMUSG00000096847

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:TMEM151 40 486 2e-213 PFAM
low complexity region 511 518 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,111,216 probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
BC004004 A G 17: 29,301,449 *349W probably null Het
Elmo2 C T 2: 165,316,002 D39N probably damaging Het
Fam161a T C 11: 23,020,410 F196S probably damaging Het
Fam186a A G 15: 99,947,535 V276A unknown Het
Fn3krp T C 11: 121,426,705 probably null Het
Gnai3 T C 3: 108,109,398 probably benign Het
Hspg2 C T 4: 137,565,504 probably benign Het
Igkv5-45 G A 6: 69,775,937 H54Y probably benign Het
Kif26b A G 1: 178,679,030 I224V probably benign Het
Lyg1 T C 1: 37,949,842 Y99C probably benign Het
Myh4 C T 11: 67,255,315 R1400C probably damaging Het
Nf1 T C 11: 79,548,747 S2262P probably benign Het
Pop5 T C 5: 115,240,508 Y117H possibly damaging Het
Prpf8 T A 11: 75,506,721 probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rapgef6 T C 11: 54,625,934 F54S probably benign Het
Sptb T C 12: 76,600,400 T1954A probably benign Het
Ssbp2 T C 13: 91,680,646 probably benign Het
Tap1 A T 17: 34,193,612 D541V probably damaging Het
Tpbg A G 9: 85,845,162 R395G probably damaging Het
Trappc10 T A 10: 78,199,090 S941C probably benign Het
Usp19 G A 9: 108,500,181 R886Q probably damaging Het
Utp14b G T 1: 78,665,256 E290D probably benign Het
Vmn1r30 A T 6: 58,435,819 Y9* probably null Het
Vmn2r97 A G 17: 18,929,628 H426R probably benign Het
Vwa3a A G 7: 120,752,594 D27G probably benign Het
Zfp36 A G 7: 28,377,776 S236P probably benign Het
Zfp616 C A 11: 74,083,987 H452N probably benign Het
Other mutations in Tcte1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Tcte1 APN 17 45534928 missense probably damaging 1.00
IGL00945:Tcte1 APN 17 45541189 missense probably benign 0.15
IGL01120:Tcte1 APN 17 45539668 missense probably damaging 0.99
IGL01132:Tcte1 APN 17 45539862 missense possibly damaging 0.93
IGL01884:Tcte1 APN 17 45539809 unclassified probably null
IGL02418:Tcte1 APN 17 45541202 missense probably benign 0.37
IGL02731:Tcte1 APN 17 45539886 missense probably benign 0.00
IGL03130:Tcte1 APN 17 45533296 missense probably damaging 1.00
R0358:Tcte1 UTSW 17 45535285 missense probably benign 0.34
R1519:Tcte1 UTSW 17 45535252 missense probably damaging 1.00
R2013:Tcte1 UTSW 17 45541311 missense probably benign 0.30
R2014:Tcte1 UTSW 17 45541311 missense probably benign 0.30
R4250:Tcte1 UTSW 17 45539691 missense probably benign 0.04
R4976:Tcte1 UTSW 17 45534928 missense probably damaging 1.00
R5398:Tcte1 UTSW 17 45539826 nonsense probably null
R6169:Tcte1 UTSW 17 45535070 missense probably benign 0.01
R6251:Tcte1 UTSW 17 45535159 missense probably benign
R6279:Tcte1 UTSW 17 45533289 missense possibly damaging 0.69
R6300:Tcte1 UTSW 17 45533289 missense possibly damaging 0.69
R6316:Tcte1 UTSW 17 45534860 missense probably benign
R6417:Tcte1 UTSW 17 45535130 missense probably damaging 0.97
R6892:Tcte1 UTSW 17 45533157 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGATTCTGCATCATCCAGTGAAC -3'
(R):5'- TCGATACAGTTGAGGCGGAG -3'

Sequencing Primer
(F):5'- GTGAACCCACCTCCTACCTGAG -3'
(R):5'- TGAGCCAGTGACTGTGCG -3'
Posted On2015-03-18