Incidental Mutation 'R3745:Aox4'
ID271144
Institutional Source Beutler Lab
Gene Symbol Aox4
Ensembl Gene ENSMUSG00000038242
Gene Namealdehyde oxidase 4
Synonyms2310003G12Rik, AOH2
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3745 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58210397-58268597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58245870 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 594 (H594Y)
Ref Sequence ENSEMBL: ENSMUSP00000048929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040442]
Predicted Effect probably damaging
Transcript: ENSMUST00000040442
AA Change: H594Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242
AA Change: H594Y

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.6e-10 PFAM
Pfam:Fer2_2 91 165 4.6e-30 PFAM
Pfam:FAD_binding_5 240 421 2.7e-47 PFAM
CO_deh_flav_C 428 532 1.19e-26 SMART
Ald_Xan_dh_C 596 699 8.22e-39 SMART
Pfam:Ald_Xan_dh_C2 709 1243 1.1e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161926
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Aox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Aox4 APN 1 58239174 missense probably damaging 1.00
IGL01011:Aox4 APN 1 58240775 nonsense probably null
IGL01634:Aox4 APN 1 58221930 missense possibly damaging 0.81
IGL01689:Aox4 APN 1 58245161 splice site probably benign
IGL01874:Aox4 APN 1 58252084 missense probably damaging 1.00
IGL02104:Aox4 APN 1 58236657 splice site probably benign
IGL02744:Aox4 APN 1 58255552 missense possibly damaging 0.90
IGL02751:Aox4 APN 1 58259052 missense probably damaging 1.00
IGL03225:Aox4 APN 1 58247227 missense possibly damaging 0.94
IGL03247:Aox4 APN 1 58264367 missense probably damaging 1.00
IGL03369:Aox4 APN 1 58262587 missense probably benign 0.01
R0138:Aox4 UTSW 1 58228866 missense probably damaging 1.00
R0243:Aox4 UTSW 1 58213076 missense probably benign
R0368:Aox4 UTSW 1 58213079 missense probably benign 0.07
R0499:Aox4 UTSW 1 58263397 critical splice donor site probably null
R0513:Aox4 UTSW 1 58217519 missense probably benign
R0513:Aox4 UTSW 1 58247300 missense probably damaging 1.00
R0546:Aox4 UTSW 1 58250174 missense probably damaging 1.00
R0591:Aox4 UTSW 1 58239102 splice site probably benign
R0825:Aox4 UTSW 1 58248909 missense possibly damaging 0.55
R1912:Aox4 UTSW 1 58264402 missense probably damaging 1.00
R1934:Aox4 UTSW 1 58245936 missense probably benign 0.01
R2180:Aox4 UTSW 1 58213067 missense probably benign 0.00
R2293:Aox4 UTSW 1 58221937 missense probably damaging 0.99
R3017:Aox4 UTSW 1 58235204 missense probably benign
R3744:Aox4 UTSW 1 58245870 missense probably damaging 1.00
R3830:Aox4 UTSW 1 58255511 missense probably damaging 0.99
R3856:Aox4 UTSW 1 58253934 missense probably damaging 1.00
R4214:Aox4 UTSW 1 58221892 missense probably damaging 0.99
R4484:Aox4 UTSW 1 58262571 missense probably damaging 1.00
R4706:Aox4 UTSW 1 58266787 missense probably damaging 1.00
R4710:Aox4 UTSW 1 58255638 missense probably damaging 1.00
R4729:Aox4 UTSW 1 58259077 nonsense probably null
R4769:Aox4 UTSW 1 58259148 missense probably null 1.00
R4809:Aox4 UTSW 1 58266649 missense probably damaging 1.00
R4989:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5082:Aox4 UTSW 1 58231483 missense possibly damaging 0.63
R5102:Aox4 UTSW 1 58240778 missense probably damaging 1.00
R5114:Aox4 UTSW 1 58246286 missense possibly damaging 0.89
R5133:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5134:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5185:Aox4 UTSW 1 58254318 missense probably damaging 1.00
R5217:Aox4 UTSW 1 58246241 nonsense probably null
R5426:Aox4 UTSW 1 58220094 missense probably damaging 1.00
R5443:Aox4 UTSW 1 58233992 splice site probably null
R5708:Aox4 UTSW 1 58245873 missense possibly damaging 0.69
R6052:Aox4 UTSW 1 58254318 nonsense probably null
R6167:Aox4 UTSW 1 58263935 missense probably damaging 1.00
R6179:Aox4 UTSW 1 58231503 missense probably benign
R6196:Aox4 UTSW 1 58217526 missense probably damaging 1.00
R6513:Aox4 UTSW 1 58213053 missense probably benign 0.01
R6781:Aox4 UTSW 1 58245109 missense probably benign 0.03
R6883:Aox4 UTSW 1 58264378 missense probably damaging 1.00
X0021:Aox4 UTSW 1 58247295 nonsense probably null
X0028:Aox4 UTSW 1 58254183 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAAACTTGGTTACCTAGTCACC -3'
(R):5'- GTTCTCGCCCAGAAGAGATG -3'

Sequencing Primer
(F):5'- AACTTGGTTACCTAGTCACCTATAG -3'
(R):5'- GTTCTCGCCCAGAAGAGATGACTAC -3'
Posted On2015-03-18