Incidental Mutation 'R3745:Aspn'
ID271180
Institutional Source Beutler Lab
Gene Symbol Aspn
Ensembl Gene ENSMUSG00000021388
Gene Nameasporin
SynonymsPLAP-1, 4631401G09Rik, SLRR1C
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R3745 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49544443-49567565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49566560 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 351 (E351K)
Ref Sequence ENSEMBL: ENSMUSP00000136728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000021820] [ENSMUST00000177948]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021820
AA Change: E351K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021820
Gene: ENSMUSG00000021388
AA Change: E351K

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
LRRNT 67 99 8.23e-6 SMART
LRR 98 117 3.36e2 SMART
LRR 118 141 2.49e-1 SMART
LRR 142 165 5.41e0 SMART
LRR 187 212 9.5e1 SMART
Blast:LRR 232 256 9e-6 BLAST
LRR 257 280 4.83e0 SMART
LRR 281 303 6.23e1 SMART
LRR 304 327 2.03e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177948
AA Change: E351K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136728
Gene: ENSMUSG00000021388
AA Change: E351K

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
LRRNT 67 99 8.23e-6 SMART
LRR 98 117 3.36e2 SMART
LRR 118 141 2.49e-1 SMART
LRR 142 165 5.41e0 SMART
LRR 187 212 9.5e1 SMART
Blast:LRR 232 256 9e-6 BLAST
LRR 257 280 4.83e0 SMART
LRR 281 303 6.23e1 SMART
LRR 304 327 2.03e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221751
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: This gene encodes a member of the small leucine-rich proteoglycan family. The encoded protein is an extracellular matrix protein that modulates the transforming growth factor-beta signaling pathway, regulating cartilage matrix gene expression and cartilage formation. The protein plays a role in the pathology of osteoarthritis. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Aspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Aspn APN 13 49566492 missense probably benign 0.06
IGL00796:Aspn APN 13 49557417 missense probably damaging 0.98
IGL01088:Aspn APN 13 49566553 missense probably benign 0.00
IGL02633:Aspn APN 13 49551887 missense possibly damaging 0.93
IGL03180:Aspn APN 13 49563515 missense probably damaging 1.00
R0699:Aspn UTSW 13 49551782 missense possibly damaging 0.63
R1445:Aspn UTSW 13 49557373 missense possibly damaging 0.75
R1749:Aspn UTSW 13 49551785 missense probably benign 0.01
R2907:Aspn UTSW 13 49551898 missense probably damaging 1.00
R3744:Aspn UTSW 13 49566560 missense probably damaging 0.96
R4625:Aspn UTSW 13 49557425 missense probably benign
R5061:Aspn UTSW 13 49566604 missense probably damaging 0.99
R5712:Aspn UTSW 13 49563519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCATGTTCCAGATAAAAC -3'
(R):5'- AGAATCATTCATGTGCAGAAGGAC -3'

Sequencing Primer
(F):5'- CACATTTCTTTTTATATTTACCGGGC -3'
(R):5'- TGAGCATCAATAATTAGGCAAAATTC -3'
Posted On2015-03-18