Incidental Mutation 'R3751:Spg7'
ID271211
Institutional Source Beutler Lab
Gene Symbol Spg7
Ensembl Gene ENSMUSG00000000738
Gene NameSPG7, paraplegin matrix AAA peptidase subunit
SynonymsCmar, paraplegin
MMRRC Submission 040736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3751 (G1)
Quality Score193
Status Validated
Chromosome8
Chromosomal Location123062942-123097760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 123087373 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 457 (R457P)
Ref Sequence ENSEMBL: ENSMUSP00000115039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108868] [ENSMUST00000125975] [ENSMUST00000127664] [ENSMUST00000135991] [ENSMUST00000149248] [ENSMUST00000153285]
Predicted Effect probably damaging
Transcript: ENSMUST00000108868
AA Change: R457P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104496
Gene: ENSMUSG00000000738
AA Change: R457P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 5.2e-12 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 1.8e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125975
AA Change: R352P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120361
Gene: ENSMUSG00000000738
AA Change: R352P

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:FtsH_ext 37 137 8.5e-12 PFAM
transmembrane domain 145 167 N/A INTRINSIC
AAA 236 376 1.96e-19 SMART
Pfam:Peptidase_M41 436 641 9.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect unknown
Transcript: ENSMUST00000128234
AA Change: R25P
SMART Domains Protein: ENSMUSP00000120793
Gene: ENSMUSG00000000738
AA Change: R25P

DomainStartEndE-ValueType
Pfam:AAA 1 48 5.8e-10 PFAM
Pfam:Peptidase_M41 110 222 9.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130787
Predicted Effect probably benign
Transcript: ENSMUST00000135991
SMART Domains Protein: ENSMUSP00000118066
Gene: ENSMUSG00000000738

DomainStartEndE-ValueType
Pfam:Peptidase_M41 1 81 2.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142150
Predicted Effect probably damaging
Transcript: ENSMUST00000149248
AA Change: R457P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119552
Gene: ENSMUSG00000000738
AA Change: R457P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.9e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 7e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152972
Predicted Effect probably damaging
Transcript: ENSMUST00000153285
AA Change: R457P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115039
Gene: ENSMUSG00000000738
AA Change: R457P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.8e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 515 709 2.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153492
SMART Domains Protein: ENSMUSP00000133602
Gene: ENSMUSG00000000738

DomainStartEndE-ValueType
Pfam:FtsH_ext 1 102 1.3e-12 PFAM
transmembrane domain 110 132 N/A INTRINSIC
PDB:2QZ4|A 165 192 1e-8 PDB
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 93% (43/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice exhibit impaired motor skills, putativley associated with axonal degeneration in the central and peripheral nervous systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G T 7: 12,556,046 R183I probably benign Het
BC016579 A T 16: 45,632,998 probably null Het
BC051665 A T 13: 60,783,331 F258I probably damaging Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
C77080 A G 4: 129,224,322 probably benign Het
Ccdc125 A G 13: 100,677,951 D13G possibly damaging Het
Ceacam18 T A 7: 43,641,948 H271Q probably damaging Het
Cep104 A G 4: 153,981,756 Y137C probably damaging Het
Clca1 A G 3: 145,018,663 V212A probably benign Het
Clca2 A T 3: 145,071,455 M885K probably benign Het
Col6a4 G T 9: 106,072,114 T774N probably damaging Het
D430041D05Rik T C 2: 104,255,058 T1049A possibly damaging Het
Dlk1 A G 12: 109,460,313 I276V probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Efcab9 T C 11: 32,527,420 H34R probably benign Het
Erc1 T A 6: 119,824,960 H32L probably damaging Het
Ezh2 T C 6: 47,556,064 I141M possibly damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Itpr1 T A 6: 108,349,680 I121N probably damaging Het
Krtap17-1 A T 11: 99,993,655 C95* probably null Het
Lrrd1 T A 5: 3,850,282 S196T probably benign Het
Man2c1 A G 9: 57,140,774 Y748C probably damaging Het
Map4 A G 9: 110,038,674 probably benign Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Mtmr9 A G 14: 63,543,548 L31P probably damaging Het
Myo5c A G 9: 75,276,002 Q886R probably damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr768 T A 10: 129,093,306 I223F probably damaging Het
Olfr871 C T 9: 20,213,260 L304F probably damaging Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Pdgfd A T 9: 6,337,447 probably benign Het
Ppm1k T G 6: 57,524,860 E106A probably benign Het
Rbp3 A T 14: 33,956,012 E639V probably damaging Het
Rnf214 A C 9: 45,867,603 I581S probably damaging Het
Scaf11 A G 15: 96,418,536 V1049A probably damaging Het
Slc51a A G 16: 32,476,474 L262P probably benign Het
Slc6a21 G A 7: 45,280,504 V139I probably benign Het
Slc8a3 G T 12: 81,204,138 L684M probably damaging Het
Tnks1bp1 C T 2: 85,058,722 probably benign Het
Vmn1r189 T C 13: 22,102,212 T152A probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp366 A G 13: 99,228,844 Y171C probably damaging Het
Other mutations in Spg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Spg7 APN 8 123076930 missense probably damaging 1.00
IGL01868:Spg7 APN 8 123090236 critical splice donor site probably null
IGL02551:Spg7 APN 8 123076978 missense probably damaging 1.00
IGL02744:Spg7 APN 8 123093661 missense probably damaging 1.00
IGL03161:Spg7 APN 8 123087331 missense probably damaging 1.00
IGL03165:Spg7 APN 8 123080812 critical splice donor site probably null
R0729:Spg7 UTSW 8 123070417 missense probably damaging 0.96
R1580:Spg7 UTSW 8 123090238 unclassified probably benign
R1696:Spg7 UTSW 8 123090225 missense probably benign 0.05
R1909:Spg7 UTSW 8 123080741 missense probably benign 0.01
R3753:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3921:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3976:Spg7 UTSW 8 123079448 missense probably damaging 1.00
R4908:Spg7 UTSW 8 123080655 missense probably damaging 1.00
R4952:Spg7 UTSW 8 123090171 missense probably damaging 1.00
R5392:Spg7 UTSW 8 123087363 missense probably damaging 1.00
R5637:Spg7 UTSW 8 123094575 missense possibly damaging 0.82
R5684:Spg7 UTSW 8 123073884 missense probably damaging 1.00
R5810:Spg7 UTSW 8 123094569 missense possibly damaging 0.94
R6452:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6453:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6454:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6750:Spg7 UTSW 8 123073911 missense probably damaging 1.00
R7090:Spg7 UTSW 8 123091752 critical splice donor site probably null
R7213:Spg7 UTSW 8 123090232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGAAGCCGTTGTGAAGG -3'
(R):5'- TAACAGCAGAGCTTCCTGTC -3'

Sequencing Primer
(F):5'- CTCATCGGTCTGTCCAGATGGAG -3'
(R):5'- AGCAGAGCTTCCTGTCCCAAG -3'
Posted On2015-03-18