Incidental Mutation 'R3754:Nr2f2'
ID 271351
Institutional Source Beutler Lab
Gene Symbol Nr2f2
Ensembl Gene ENSMUSG00000030551
Gene Name nuclear receptor subfamily 2, group F, member 2
Synonyms COUP-TF2, EAR3, ARP-1, Tcfcoup2, 9430015G03Rik, COUP-TFII, Aporp1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3754 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 70001692-70016483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70007769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 238 (I238V)
Ref Sequence ENSEMBL: ENSMUSP00000032768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032768] [ENSMUST00000089565] [ENSMUST00000208081]
AlphaFold P43135
Predicted Effect probably benign
Transcript: ENSMUST00000032768
AA Change: I238V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032768
Gene: ENSMUSG00000030551
AA Change: I238V

DomainStartEndE-ValueType
low complexity region 21 75 N/A INTRINSIC
ZnF_C4 76 147 4.57e-39 SMART
HOLI 214 374 1.29e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089565
AA Change: I105V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086993
Gene: ENSMUSG00000030551
AA Change: I105V

DomainStartEndE-ValueType
HOLI 81 241 5.2e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207153
Predicted Effect probably benign
Transcript: ENSMUST00000208081
AA Change: I85V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208681
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid thyroid hormone superfamily of nuclear receptors. The encoded protein is a ligand inducible transcription factor that is involved in the regulation of many different genes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired angiogenesis and heart development with hemorrhagic brains and hearts, and die around embryonic day 10. About 5% of heterozygotes share the hemorrhagic phenotype at embryonic day 9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 135,956,766 (GRCm39) probably null Het
Atp12a G A 14: 56,610,045 (GRCm39) V182I probably benign Het
Gad2 A T 2: 22,571,352 (GRCm39) D430V possibly damaging Het
Hr A G 14: 70,805,264 (GRCm39) E1002G probably damaging Het
Itpkc G T 7: 26,927,857 (GRCm39) P19Q probably damaging Het
Lrrc72 A G 12: 36,262,567 (GRCm39) S42P probably benign Het
Med1 A G 11: 98,057,548 (GRCm39) V318A possibly damaging Het
Myef2l G A 3: 10,153,575 (GRCm39) V115I possibly damaging Het
Nek11 A T 9: 105,191,917 (GRCm39) N164K probably damaging Het
Neurod2 A G 11: 98,218,526 (GRCm39) S213P probably damaging Het
Nhsl1 A G 10: 18,391,782 (GRCm39) N179D probably damaging Het
Rpl37 C A 15: 5,146,770 (GRCm39) T2K possibly damaging Het
Slf2 A G 19: 44,961,676 (GRCm39) D1065G probably benign Het
Smim5 T C 11: 115,796,549 (GRCm39) C57R probably damaging Het
Soat2 T A 15: 102,065,513 (GRCm39) V236D probably damaging Het
Teddm3 C T 16: 20,971,898 (GRCm39) D224N possibly damaging Het
Tm2d2 G A 8: 25,510,494 (GRCm39) V118I probably damaging Het
Ttc22 C A 4: 106,496,278 (GRCm39) R443S probably damaging Het
Upf1 A G 8: 70,792,464 (GRCm39) I368T probably benign Het
Xrn1 G T 9: 95,849,841 (GRCm39) D129Y probably damaging Het
Zfp109 A G 7: 23,929,181 (GRCm39) M76T probably benign Het
Znrf1 G A 8: 112,345,843 (GRCm39) V76M probably damaging Het
Other mutations in Nr2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Nr2f2 APN 7 70,007,514 (GRCm39) missense possibly damaging 0.88
IGL01736:Nr2f2 APN 7 70,004,446 (GRCm39) missense probably damaging 1.00
IGL02667:Nr2f2 APN 7 70,007,733 (GRCm39) missense probably damaging 1.00
R0149:Nr2f2 UTSW 7 70,007,810 (GRCm39) missense possibly damaging 0.90
R0206:Nr2f2 UTSW 7 70,009,923 (GRCm39) missense probably damaging 0.98
R0207:Nr2f2 UTSW 7 70,009,923 (GRCm39) missense probably damaging 0.98
R0240:Nr2f2 UTSW 7 70,009,923 (GRCm39) missense probably damaging 0.98
R0243:Nr2f2 UTSW 7 70,009,923 (GRCm39) missense probably damaging 0.98
R0361:Nr2f2 UTSW 7 70,007,810 (GRCm39) missense possibly damaging 0.90
R0540:Nr2f2 UTSW 7 70,004,460 (GRCm39) missense probably damaging 1.00
R0607:Nr2f2 UTSW 7 70,004,460 (GRCm39) missense probably damaging 1.00
R0741:Nr2f2 UTSW 7 70,007,745 (GRCm39) missense probably damaging 1.00
R1894:Nr2f2 UTSW 7 70,004,419 (GRCm39) missense probably benign 0.00
R1961:Nr2f2 UTSW 7 70,007,903 (GRCm39) missense possibly damaging 0.80
R3033:Nr2f2 UTSW 7 70,007,810 (GRCm39) missense possibly damaging 0.90
R4517:Nr2f2 UTSW 7 70,007,870 (GRCm39) missense probably benign 0.21
R6175:Nr2f2 UTSW 7 70,007,946 (GRCm39) missense probably damaging 1.00
R6226:Nr2f2 UTSW 7 70,009,744 (GRCm39) missense probably benign 0.00
R7544:Nr2f2 UTSW 7 70,004,499 (GRCm39) missense probably damaging 1.00
R7796:Nr2f2 UTSW 7 70,007,901 (GRCm39) missense probably benign 0.03
R7894:Nr2f2 UTSW 7 70,009,681 (GRCm39) missense probably damaging 1.00
R9377:Nr2f2 UTSW 7 70,007,856 (GRCm39) missense probably damaging 1.00
R9411:Nr2f2 UTSW 7 70,007,525 (GRCm39) missense
R9513:Nr2f2 UTSW 7 70,010,056 (GRCm39) missense probably damaging 0.98
Z1176:Nr2f2 UTSW 7 70,007,526 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTTGAGGCAGCTATACTCG -3'
(R):5'- GGATATATTTCCCTGCTGCTGC -3'

Sequencing Primer
(F):5'- ACTTGCTCTTGGAAGATCCG -3'
(R):5'- GGGCATCGAGAACATTTG -3'
Posted On 2015-03-18