Incidental Mutation 'R3751:BC016579'
List |< first << previous [record 19 of 217] next >> last >|
ID271542
Institutional Source Beutler Lab
Gene Symbol BC016579
Ensembl Gene ENSMUSG00000033187
Gene NamecDNA sequence, BC016579
Synonyms
MMRRC Submission 040736-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3751 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location45626848-45654068 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) A to T at 45632998 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036732]
Predicted Effect probably null
Transcript: ENSMUST00000036732
SMART Domains Protein: ENSMUSP00000037651
Gene: ENSMUSG00000033187

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 123 135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 93% (43/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G T 7: 12,556,046 R183I probably benign Het
BC051665 A T 13: 60,783,331 F258I probably damaging Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
C77080 A G 4: 129,224,322 probably benign Het
Ccdc125 A G 13: 100,677,951 D13G possibly damaging Het
Ceacam18 T A 7: 43,641,948 H271Q probably damaging Het
Cep104 A G 4: 153,981,756 Y137C probably damaging Het
Clca1 A G 3: 145,018,663 V212A probably benign Het
Clca2 A T 3: 145,071,455 M885K probably benign Het
Col6a4 G T 9: 106,072,114 T774N probably damaging Het
D430041D05Rik T C 2: 104,255,058 T1049A possibly damaging Het
Dlk1 A G 12: 109,460,313 I276V probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Efcab9 T C 11: 32,527,420 H34R probably benign Het
Erc1 T A 6: 119,824,960 H32L probably damaging Het
Ezh2 T C 6: 47,556,064 I141M possibly damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Itpr1 T A 6: 108,349,680 I121N probably damaging Het
Krtap17-1 A T 11: 99,993,655 C95* probably null Het
Lrrd1 T A 5: 3,850,282 S196T probably benign Het
Man2c1 A G 9: 57,140,774 Y748C probably damaging Het
Map4 A G 9: 110,038,674 probably benign Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Mtmr9 A G 14: 63,543,548 L31P probably damaging Het
Myo5c A G 9: 75,276,002 Q886R probably damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr768 T A 10: 129,093,306 I223F probably damaging Het
Olfr871 C T 9: 20,213,260 L304F probably damaging Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Pdgfd A T 9: 6,337,447 probably benign Het
Ppm1k T G 6: 57,524,860 E106A probably benign Het
Rbp3 A T 14: 33,956,012 E639V probably damaging Het
Rnf214 A C 9: 45,867,603 I581S probably damaging Het
Scaf11 A G 15: 96,418,536 V1049A probably damaging Het
Slc51a A G 16: 32,476,474 L262P probably benign Het
Slc6a21 G A 7: 45,280,504 V139I probably benign Het
Slc8a3 G T 12: 81,204,138 L684M probably damaging Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Tnks1bp1 C T 2: 85,058,722 probably benign Het
Vmn1r189 T C 13: 22,102,212 T152A probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp366 A G 13: 99,228,844 Y171C probably damaging Het
Other mutations in BC016579
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02818:BC016579 APN 16 45629502 missense probably damaging 0.99
IGL03061:BC016579 APN 16 45629486 missense probably damaging 0.98
R0026:BC016579 UTSW 16 45640367 missense probably benign 0.02
R0026:BC016579 UTSW 16 45640367 missense probably benign 0.02
R0763:BC016579 UTSW 16 45629455 missense probably damaging 0.97
R3424:BC016579 UTSW 16 45629483 missense probably damaging 0.97
R4512:BC016579 UTSW 16 45633000 missense possibly damaging 0.61
R5447:BC016579 UTSW 16 45648889 missense probably benign 0.00
R5508:BC016579 UTSW 16 45633006 missense possibly damaging 0.59
Z1088:BC016579 UTSW 16 45653948 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAGATGTTGCCCTGCACCAC -3'
(R):5'- CTTTGATTTGTGGTCAGCTTACAC -3'

Sequencing Primer
(F):5'- ACTGCAGCGTGACACTGTG -3'
(R):5'- CAGAACCCCAAACCAGTGAATTC -3'
Posted On2015-03-18