Incidental Mutation 'R3150:Tie1'
ID271619
Institutional Source Beutler Lab
Gene Symbol Tie1
Ensembl Gene ENSMUSG00000033191
Gene Nametyrosine kinase with immunoglobulin-like and EGF-like domains 1
SynonymsTIE, D430008P04Rik, tie-1
MMRRC Submission 040602-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3150 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118471191-118490061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118475825 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 902 (A902V)
Ref Sequence ENSEMBL: ENSMUSP00000037129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047421] [ENSMUST00000184261]
Predicted Effect probably damaging
Transcript: ENSMUST00000047421
AA Change: A902V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037129
Gene: ENSMUSG00000033191
AA Change: A902V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
FN3 640 722 6.95e-10 SMART
transmembrane domain 760 782 N/A INTRINSIC
TyrKc 835 1103 5.05e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153286
Predicted Effect probably benign
Transcript: ENSMUST00000184261
SMART Domains Protein: ENSMUSP00000139279
Gene: ENSMUSG00000033191

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic or neonatal lethality, hemorrhages, edema, increased vascular branching, and abnormal vascular endothelial cell development. Mice homozygous for a hypomorphic allele exhibit dilated and disorganized lymphatic vessel, edema, and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,154,195 T1528N probably benign Het
Akna A T 4: 63,395,353 S178T possibly damaging Het
BC067074 A T 13: 113,351,760 Q105H probably damaging Het
Cabin1 A G 10: 75,656,911 L1850P probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Ces1g C T 8: 93,325,816 V282I probably benign Het
Col4a3 T G 1: 82,657,137 probably null Het
Crat C T 2: 30,413,859 probably null Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Ddb1 T A 19: 10,612,982 M291K probably benign Het
Gfod2 C T 8: 105,717,221 G230D probably benign Het
Git2 A G 5: 114,730,349 S257P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hjurp A G 1: 88,266,561 probably benign Het
Hnrnph1 T A 11: 50,385,792 V439E probably benign Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Map3k20 C T 2: 72,371,992 T189M probably damaging Het
Mapk11 T C 15: 89,145,450 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nmral1 G A 16: 4,716,469 T36I probably damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1475 A G 19: 13,479,460 V246A probably damaging Het
Olfr860 A G 9: 19,846,214 I135T possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pkd1 G T 17: 24,579,791 R2691L probably benign Het
Ppp2r2a G A 14: 67,023,765 R169W probably damaging Het
Prdm1 A T 10: 44,458,492 probably null Het
Robo1 C T 16: 72,970,269 P443L possibly damaging Het
Rtn4 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 11: 29,693,308 probably benign Het
Shprh A G 10: 11,170,030 H865R probably damaging Het
Spats1 A T 17: 45,464,554 S15T probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
Usp22 T C 11: 61,160,581 Q312R probably damaging Het
Vmn2r32 T C 7: 7,472,555 Y443C probably benign Het
Vps13d A C 4: 145,086,790 D3274E probably damaging Het
Wdr62 A T 7: 30,271,670 N167K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim7 A T 11: 62,273,785 I43N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Tie1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tie1 APN 4 118476098 missense probably damaging 1.00
IGL01679:Tie1 APN 4 118482739 missense probably benign 0.00
IGL01821:Tie1 APN 4 118484638 missense probably damaging 0.99
IGL01892:Tie1 APN 4 118475918 missense probably benign
IGL02101:Tie1 APN 4 118472798 missense probably benign 0.42
IGL02411:Tie1 APN 4 118486563 nonsense probably null
IGL02421:Tie1 APN 4 118486394 missense probably damaging 1.00
IGL02892:Tie1 APN 4 118486282 missense probably damaging 1.00
IGL03294:Tie1 APN 4 118480223 missense probably damaging 1.00
IGL03346:Tie1 APN 4 118472828 missense probably damaging 1.00
R0064:Tie1 UTSW 4 118489701 missense possibly damaging 0.94
R0067:Tie1 UTSW 4 118476280 splice site probably benign
R0080:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0082:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0098:Tie1 UTSW 4 118486587 missense probably benign
R0329:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0330:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0410:Tie1 UTSW 4 118480569 missense probably damaging 1.00
R0472:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0498:Tie1 UTSW 4 118479161 utr 3 prime probably benign
R0521:Tie1 UTSW 4 118476146 missense probably damaging 1.00
R0609:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0675:Tie1 UTSW 4 118479769 nonsense probably null
R0830:Tie1 UTSW 4 118482663 missense probably damaging 1.00
R1541:Tie1 UTSW 4 118483873 missense probably damaging 0.99
R1604:Tie1 UTSW 4 118474407 missense probably damaging 1.00
R1731:Tie1 UTSW 4 118476263 missense probably damaging 1.00
R1751:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1767:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1953:Tie1 UTSW 4 118472790 critical splice donor site probably null
R1986:Tie1 UTSW 4 118478963 missense probably benign
R2141:Tie1 UTSW 4 118472811 nonsense probably null
R4235:Tie1 UTSW 4 118478405 nonsense probably null
R4599:Tie1 UTSW 4 118472634 missense probably benign 0.00
R4614:Tie1 UTSW 4 118479051 missense probably damaging 1.00
R4623:Tie1 UTSW 4 118486611 missense possibly damaging 0.71
R4638:Tie1 UTSW 4 118483842 missense probably benign 0.00
R4717:Tie1 UTSW 4 118486217 missense probably damaging 1.00
R4936:Tie1 UTSW 4 118484771 splice site silent
R4983:Tie1 UTSW 4 118483755 missense probably damaging 1.00
R5202:Tie1 UTSW 4 118480510 missense probably benign 0.01
R5234:Tie1 UTSW 4 118482762 missense probably benign 0.22
R5243:Tie1 UTSW 4 118482351 missense probably damaging 0.99
R5538:Tie1 UTSW 4 118486193 missense probably benign 0.10
R5881:Tie1 UTSW 4 118475603 missense possibly damaging 0.89
R6045:Tie1 UTSW 4 118484691 missense probably benign 0.05
R6073:Tie1 UTSW 4 118482390 missense probably benign
R6476:Tie1 UTSW 4 118472865 missense possibly damaging 0.82
R6820:Tie1 UTSW 4 118484386 missense probably damaging 1.00
R6961:Tie1 UTSW 4 118486205 missense probably damaging 1.00
R7022:Tie1 UTSW 4 118489653 missense probably benign 0.00
R7029:Tie1 UTSW 4 118484626 missense possibly damaging 0.93
R7147:Tie1 UTSW 4 118484413 missense probably damaging 1.00
R7249:Tie1 UTSW 4 118486228 missense probably benign 0.29
R7410:Tie1 UTSW 4 118479877 missense probably benign
R7486:Tie1 UTSW 4 118479904 critical splice acceptor site probably null
Z1088:Tie1 UTSW 4 118484429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGGCCATGAGCAGTAC -3'
(R):5'- TCCTTGGTCATGACTCCAGAGC -3'

Sequencing Primer
(F):5'- CATGAGCAGTACCCGATGG -3'
(R):5'- ATGACTCCAGAGCCCCGTTC -3'
Posted On2015-03-25