Incidental Mutation 'R3162:Hnrnpu'
ID271662
Institutional Source Beutler Lab
Gene Symbol Hnrnpu
Ensembl Gene ENSMUSG00000039630
Gene Nameheterogeneous nuclear ribonucleoprotein U
SynonymsHnrpu, scaffold attachment factor A, Sp120
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location178321108-178337797 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 178331125 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000037748] [ENSMUST00000161769]
Predicted Effect unknown
Transcript: ENSMUST00000037748
AA Change: D603G
SMART Domains Protein: ENSMUSP00000047571
Gene: ENSMUSG00000039630
AA Change: D603G

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 2e-30 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150825
Predicted Effect unknown
Transcript: ENSMUST00000161769
AA Change: D603G
SMART Domains Protein: ENSMUSP00000124147
Gene: ENSMUSG00000039630
AA Change: D603G

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 6.7e-31 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 773 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162916
Predicted Effect probably benign
Transcript: ENSMUST00000188044
Predicted Effect probably benign
Transcript: ENSMUST00000189450
Meta Mutation Damage Score 0.376 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they form complexes with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene contains a RNA binding domain and scaffold-associated region (SAR)-specific bipartite DNA-binding domain. This protein is also thought to be involved in the packaging of hnRNA into large ribonucleoprotein complexes. During apoptosis, this protein is cleaved in a caspase-dependent way. Cleavage occurs at the SALD site, resulting in a loss of DNA-binding activity and a concomitant detachment of this protein from nuclear structural sites. But this cleavage does not affect the function of the encoded protein in RNA metabolism. At least two alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality, delayed embryonic development, and failure of chorioallantoic fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgre4 T C 17: 55,802,218 probably benign Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cdc14b A G 13: 64,246,608 probably benign Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Epsti1 A T 14: 77,974,513 probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Fam84b A T 15: 60,823,447 V150E probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Trak1 C T 9: 121,451,734 probably benign Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Hnrnpu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Hnrnpu APN 1 178330774 unclassified probably benign
R1136:Hnrnpu UTSW 1 178331225 unclassified probably benign
R1205:Hnrnpu UTSW 1 178332169 unclassified probably benign
R1317:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1318:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1778:Hnrnpu UTSW 1 178325241 critical splice donor site probably benign
R3160:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3161:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3162:Hnrnpu UTSW 1 178331125 unclassified probably benign
R4408:Hnrnpu UTSW 1 178330803 unclassified probably benign
R4667:Hnrnpu UTSW 1 178332181 unclassified probably benign
R4833:Hnrnpu UTSW 1 178333894 unclassified probably benign
R4906:Hnrnpu UTSW 1 178329373 intron probably benign
R4923:Hnrnpu UTSW 1 178331452 unclassified probably benign
R5000:Hnrnpu UTSW 1 178329376 intron probably benign
R5256:Hnrnpu UTSW 1 178335893 missense unknown
R5307:Hnrnpu UTSW 1 178337312 missense unknown
R5911:Hnrnpu UTSW 1 178330172 unclassified probably benign
R6931:Hnrnpu UTSW 1 178331432 unclassified probably benign
R7061:Hnrnpu UTSW 1 178336126 missense unknown
R7077:Hnrnpu UTSW 1 178332191 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCAGTTATCTGGTCACGGCC -3'
(R):5'- TGGATCAGGTAAGTAGTAGCTTTGAAG -3'

Sequencing Primer
(F):5'- GGTCACGGCCTTCATCAC -3'
(R):5'- ATTGGTAAGGTGTAACATTAACGTC -3'
Posted On2015-03-25