Incidental Mutation 'R3162:0610040J01Rik'
List |< first << previous [record 70 of 386652] next >> last >|
ID271671
Institutional Source Beutler Lab
Gene Symbol 0610040J01Rik
Ensembl Gene ENSMUSG00000060512
Gene NameRIKEN cDNA 0610040J01 gene
Synonyms
MMRRC Submission 040613-MU
Accession Numbers
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location63812495-63899619 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 63896490 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081747]
Predicted Effect probably benign
Transcript: ENSMUST00000081747
SMART Domains Protein: ENSMUSP00000080443
Gene: ENSMUSG00000060512

DomainStartEndE-ValueType
Pfam:DUF4699 9 313 2.5e-123 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
1810034E14Rik A G 13: 64,246,608 probably benign Het
Adap1 T A 5: 139,273,023 I413F noncoding transcript Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgre4 T C 17: 55,802,218 probably benign Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Col22a1 A T 15: 71,933,415 S204T noncoding transcript Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Epsti1 A T 14: 77,974,513 probably benign Het
Erp29 A G 5: 121,435,072 probably null Het
Gm6654 T C 6: 146,647,350 H80R noncoding transcript Het
Gm7337 A C 5: 87,851,557 Y400S noncoding transcript Het
Hnrnpu T C 1: 178,331,125 D603G unknown Het
Hoxa11os A T 6: 52,245,624 K411M noncoding transcript Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A180S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Orc3 T C 4: 34,605,565 E106G noncoding transcript Het
Pde5a T A 3: 122,781,628 L388* probably null Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S239P probably benign Het
Sgk3 G T 1: 9,886,189 S236I noncoding transcript Het
Slco2a1 T A 9: 103,008,744 C197* probably null Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Trak1 C T 9: 121,451,734 probably benign Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wdr61 T A 9: 54,724,189 T57S noncoding transcript Het
Yeats2 T C 16: 20,193,645 V587A probably damaging Het
Other mutations in 0610040J01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:0610040J01Rik APN 5 63898383 missense possibly damaging 0.60
IGL02229:0610040J01Rik APN 5 63898353 missense possibly damaging 0.51
IGL02389:0610040J01Rik APN 5 63896483 missense probably benign 0.20
IGL02411:0610040J01Rik APN 5 63898116 missense probably benign 0.00
R0243:0610040J01Rik UTSW 5 63898463 missense probably benign 0.09
R0411:0610040J01Rik UTSW 5 63896491 splice donor site probably benign
R1978:0610040J01Rik UTSW 5 63898537 nonsense probably null
R2072:0610040J01Rik UTSW 5 63898737 missense possibly damaging 0.79
R2202:0610040J01Rik UTSW 5 63898668 missense possibly damaging 0.89
R3161:0610040J01Rik UTSW 5 63896490 splice site probably benign
R4428:0610040J01Rik UTSW 5 63898839 missense unknown
R4429:0610040J01Rik UTSW 5 63898839 missense unknown
R4430:0610040J01Rik UTSW 5 63898839 missense unknown
R4431:0610040J01Rik UTSW 5 63898839 missense unknown
R4464:0610040J01Rik UTSW 5 63898839 missense unknown
R4465:0610040J01Rik UTSW 5 63898839 missense unknown
R4467:0610040J01Rik UTSW 5 63898839 missense unknown
R4491:0610040J01Rik UTSW 5 63898469 missense probably damaging 1.00
R5161:0610040J01Rik UTSW 5 63898001 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCATGTGTGGCTTAAAGACATGAG -3'
(R):5'- ATGCAATAGTGTCAAGGTTTGG -3'

Sequencing Primer
(F):5'- CTTAAAGACATGAGGGGGTTCTGTC -3'
(R):5'- GGCTGATTATGGGATGGATCC -3'
Posted OnMar 25, 2015