Incidental Mutation 'R3162:Crbn'
ID271677
Institutional Source Beutler Lab
Gene Symbol Crbn
Ensembl Gene ENSMUSG00000005362
Gene Namecereblon
Synonyms
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location106780201-106800077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106790866 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 221 (Q221R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013882] [ENSMUST00000113239] [ENSMUST00000151484]
Predicted Effect probably benign
Transcript: ENSMUST00000013882
AA Change: Q220R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000013882
Gene: ENSMUSG00000005362
AA Change: Q220R

DomainStartEndE-ValueType
low complexity region 23 39 N/A INTRINSIC
LON 82 319 2.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049675
AA Change: Q221R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061604
Gene: ENSMUSG00000005362
AA Change: Q221R

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
LON 83 320 2.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113239
AA Change: Q221R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108865
Gene: ENSMUSG00000005362
AA Change: Q221R

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
LON 83 320 2.33e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147087
Predicted Effect probably benign
Transcript: ENSMUST00000151484
AA Change: Q208R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144723
Gene: ENSMUSG00000005362
AA Change: Q208R

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
LON 70 253 3.1e-9 SMART
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: This gene encodes a protein with a Lon protease domain, a "regulators of G protein-signaling" (RGS)-like domain and a leucine zipper. It has been proposed to regulate the assembly and surface expression of large-conductance calcium-activated potassium channels in brain and to bind thalidomide. In humans mutation in this gene causes autosomal recessive nonsyndromic mental retardation. In mouse deficiency of this gene serves as a model to study the molecular mechanisms governing learning and memory as they relate to intellectual disability. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired contextual conditioning behavior. Mice homozygous for another knock-out allele exhibit resistance to diet-induced obesity, liver steatosis, glucose intolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgre4 T C 17: 55,802,218 probably benign Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cdc14b A G 13: 64,246,608 probably benign Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Epsti1 A T 14: 77,974,513 probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Fam84b A T 15: 60,823,447 V150E probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Trak1 C T 9: 121,451,734 probably benign Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Crbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:Crbn APN 6 106795043 missense possibly damaging 0.78
PIT4810001:Crbn UTSW 6 106784479 nonsense probably null
R0457:Crbn UTSW 6 106781057 missense probably benign 0.06
R1468:Crbn UTSW 6 106790843 missense probably benign 0.07
R1468:Crbn UTSW 6 106790843 missense probably benign 0.07
R1672:Crbn UTSW 6 106795925 missense probably damaging 1.00
R1710:Crbn UTSW 6 106790945 missense possibly damaging 0.90
R2255:Crbn UTSW 6 106795198 critical splice acceptor site probably null
R2427:Crbn UTSW 6 106783472 missense probably damaging 1.00
R3160:Crbn UTSW 6 106790866 missense probably benign 0.00
R3765:Crbn UTSW 6 106795026 missense possibly damaging 0.64
R3766:Crbn UTSW 6 106795026 missense possibly damaging 0.64
R4674:Crbn UTSW 6 106790971 missense possibly damaging 0.95
R4703:Crbn UTSW 6 106782922 missense possibly damaging 0.66
R5089:Crbn UTSW 6 106781718 missense possibly damaging 0.76
R5436:Crbn UTSW 6 106795900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCATAAATAATGGCCGGCG -3'
(R):5'- GTCAGTTTGCTTAATAAGGGGAACTTG -3'

Sequencing Primer
(F):5'- GGCCGGCGAATTATTTTTAAATCC -3'
(R):5'- GTGCAGATTTTGCCAGAG -3'
Posted On2015-03-25