Incidental Mutation 'R3162:Irak2'
ID271679
Institutional Source Beutler Lab
Gene Symbol Irak2
Ensembl Gene ENSMUSG00000060477
Gene Nameinterleukin-1 receptor-associated kinase 2
Synonyms6330415L08Rik, IRAK-2
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113638467-113695026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113672760 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 119 (A119S)
Ref Sequence ENSEMBL: ENSMUSP00000086417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059286] [ENSMUST00000089022] [ENSMUST00000089023] [ENSMUST00000204744]
Predicted Effect probably benign
Transcript: ENSMUST00000059286
AA Change: A180S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000055073
Gene: ENSMUSG00000060477
AA Change: A180S

DomainStartEndE-ValueType
Pfam:Death 14 94 4.8e-16 PFAM
Pfam:Pkinase 208 473 4.8e-28 PFAM
Pfam:Pkinase_Tyr 208 482 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089022
AA Change: A132S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000086416
Gene: ENSMUSG00000060477
AA Change: A132S

DomainStartEndE-ValueType
Pfam:Death 14 93 3.9e-16 PFAM
Pfam:Pkinase 160 425 1.3e-30 PFAM
Pfam:Pkinase_Tyr 160 436 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089023
AA Change: A119S

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000086417
Gene: ENSMUSG00000060477
AA Change: A119S

DomainStartEndE-ValueType
PDB:3MOP|N 2 35 3e-13 PDB
Pfam:Pkinase 147 412 1.2e-30 PFAM
Pfam:Pkinase_Tyr 147 419 9.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113024
SMART Domains Protein: ENSMUSP00000108647
Gene: ENSMUSG00000060477

DomainStartEndE-ValueType
Pfam:Pkinase 65 330 1.4e-30 PFAM
Pfam:Pkinase_Tyr 65 342 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155554
SMART Domains Protein: ENSMUSP00000117755
Gene: ENSMUSG00000060477

DomainStartEndE-ValueType
SCOP:d1b6cb_ 53 96 8e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203466
Predicted Effect probably benign
Transcript: ENSMUST00000204744
SMART Domains Protein: ENSMUSP00000144848
Gene: ENSMUSG00000060477

DomainStartEndE-ValueType
PDB:3MOP|N 2 55 3e-30 PDB
SCOP:d1d2za_ 4 55 9e-13 SMART
Meta Mutation Damage Score 0.1196 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRAK2 encodes the interleukin-1 receptor-associated kinase 2, one of two putative serine/threonine kinases that become associated with the interleukin-1 receptor (IL1R) upon stimulation. IRAK2 is reported to participate in the IL1-induced upregulation of NF-kappaB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgre4 T C 17: 55,802,218 probably benign Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cdc14b A G 13: 64,246,608 probably benign Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Epsti1 A T 14: 77,974,513 probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Fam84b A T 15: 60,823,447 V150E probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Trak1 C T 9: 121,451,734 probably benign Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Irak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Irak2 APN 6 113678675 missense probably benign 0.41
IGL03026:Irak2 APN 6 113676651 missense probably damaging 1.00
R0047:Irak2 UTSW 6 113672953 splice site probably benign
R0047:Irak2 UTSW 6 113678738 missense probably benign 0.43
R0658:Irak2 UTSW 6 113638564 missense probably damaging 1.00
R1120:Irak2 UTSW 6 113675759 unclassified probably benign
R2143:Irak2 UTSW 6 113672827 missense probably benign 0.03
R2190:Irak2 UTSW 6 113686943 missense probably damaging 1.00
R2342:Irak2 UTSW 6 113693671 missense probably benign 0.08
R2507:Irak2 UTSW 6 113647678 missense probably damaging 1.00
R3160:Irak2 UTSW 6 113672760 missense probably benign 0.18
R4231:Irak2 UTSW 6 113690856 missense probably damaging 0.98
R4604:Irak2 UTSW 6 113672887 missense probably damaging 1.00
R4772:Irak2 UTSW 6 113693722 missense probably damaging 1.00
R4940:Irak2 UTSW 6 113693730 missense probably benign 0.41
R5082:Irak2 UTSW 6 113672844 missense probably damaging 1.00
R5118:Irak2 UTSW 6 113665811 missense probably benign 0.00
R5194:Irak2 UTSW 6 113690790 missense probably benign 0.00
R5604:Irak2 UTSW 6 113690831 missense possibly damaging 0.91
R5928:Irak2 UTSW 6 113676626 missense probably damaging 1.00
R6479:Irak2 UTSW 6 113686941 missense probably damaging 0.99
R7102:Irak2 UTSW 6 113686849 missense probably damaging 1.00
R7153:Irak2 UTSW 6 113678709 missense probably benign 0.34
R7199:Irak2 UTSW 6 113673084 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAACAGACTCATCTTTAATTGCC -3'
(R):5'- GGGAAAATACACAGCCCCTG -3'

Sequencing Primer
(F):5'- ATTGCCTGTTTTTGCCTAGAATAG -3'
(R):5'- ACCTCCCTGAGCTTCTTGAAGG -3'
Posted On2015-03-25