Incidental Mutation 'R3162:Adcy9'
ID271700
Institutional Source Beutler Lab
Gene Symbol Adcy9
Ensembl Gene ENSMUSG00000005580
Gene Nameadenylate cyclase 9
SynonymsD16Wsu65e, ACtp10
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4287529-4420498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4311588 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 715 (L715P)
Ref Sequence ENSEMBL: ENSMUSP00000113498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005719] [ENSMUST00000117801] [ENSMUST00000120080]
Predicted Effect probably damaging
Transcript: ENSMUST00000005719
AA Change: L715P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005719
Gene: ENSMUSG00000005580
AA Change: L715P

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117801
AA Change: L715P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113498
Gene: ENSMUSG00000005580
AA Change: L715P

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120080
AA Change: L478P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113421
Gene: ENSMUSG00000005580
AA Change: L478P

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 44 63 N/A INTRINSIC
CYCc 88 310 1.69e-63 SMART
transmembrane domain 554 576 N/A INTRINSIC
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
transmembrane domain 653 675 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
CYCc 786 990 1.26e-39 SMART
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. It is regulated by a family of G protein-coupled receptors, protein kinases, and calcium. The type 9 adenylyl cyclase is a widely distributed adenylyl cyclase, and it is stimulated by beta-adrenergic receptor activation but is insensitive to forskolin, calcium, and somatostatin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show an increased IgG1 response to ovalbumin challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
Adgre4 T C 17: 55,802,218 probably benign Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cdc14b A G 13: 64,246,608 probably benign Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Epsti1 A T 14: 77,974,513 probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Fam84b A T 15: 60,823,447 V150E probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Trak1 C T 9: 121,451,734 probably benign Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Adcy9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Adcy9 APN 16 4304582 missense probably benign
IGL00326:Adcy9 APN 16 4294696 missense probably benign
IGL00792:Adcy9 APN 16 4288539 missense probably damaging 1.00
IGL01610:Adcy9 APN 16 4418114 missense probably damaging 1.00
IGL02376:Adcy9 APN 16 4418680 missense probably benign 0.01
IGL02424:Adcy9 APN 16 4288597 missense probably damaging 1.00
IGL03097:Adcy9 UTSW 16 4418066 missense possibly damaging 0.94
PIT4243001:Adcy9 UTSW 16 4418407 missense probably damaging 1.00
R0043:Adcy9 UTSW 16 4289015 missense probably benign 0.12
R0085:Adcy9 UTSW 16 4288224 missense probably benign
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0371:Adcy9 UTSW 16 4288047 missense probably benign 0.06
R0613:Adcy9 UTSW 16 4419539 missense probably damaging 1.00
R0689:Adcy9 UTSW 16 4312804 splice site probably benign
R0744:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R0836:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R1223:Adcy9 UTSW 16 4298748 missense probably damaging 1.00
R1251:Adcy9 UTSW 16 4311531 missense probably damaging 0.99
R1689:Adcy9 UTSW 16 4297562 splice site probably null
R1922:Adcy9 UTSW 16 4311657 missense probably damaging 1.00
R1955:Adcy9 UTSW 16 4418659 missense possibly damaging 0.63
R1989:Adcy9 UTSW 16 4298727 missense probably damaging 1.00
R1998:Adcy9 UTSW 16 4297412 missense probably benign 0.00
R2321:Adcy9 UTSW 16 4288268 missense probably damaging 1.00
R3160:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3161:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R4065:Adcy9 UTSW 16 4288434 missense probably damaging 1.00
R4909:Adcy9 UTSW 16 4298754 missense probably benign 0.03
R5078:Adcy9 UTSW 16 4323907 missense probably benign 0.00
R5870:Adcy9 UTSW 16 4418368 missense probably damaging 1.00
R5968:Adcy9 UTSW 16 4298742 missense probably damaging 1.00
R5975:Adcy9 UTSW 16 4311567 missense probably damaging 0.98
R6014:Adcy9 UTSW 16 4418819 missense probably damaging 1.00
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6081:Adcy9 UTSW 16 4294681 missense probably benign
R6192:Adcy9 UTSW 16 4287954 missense probably benign
R6604:Adcy9 UTSW 16 4304407 missense probably damaging 0.98
R6739:Adcy9 UTSW 16 4418794 missense probably benign
R6829:Adcy9 UTSW 16 4307154 critical splice donor site probably null
R6986:Adcy9 UTSW 16 4311577 missense probably damaging 0.99
X0023:Adcy9 UTSW 16 4323916 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGTATATCAGGCAGTATATAGTG -3'
(R):5'- TTGACTCCCAGGACTCAGTG -3'

Sequencing Primer
(F):5'- GTGAATTTCAAGTTACCCCATAACAC -3'
(R):5'- TCCCAGGACTCAGTGTGGAG -3'
Posted On2015-03-25