Incidental Mutation 'R3162:Tulp4'
ID271704
Institutional Source Beutler Lab
Gene Symbol Tulp4
Ensembl Gene ENSMUSG00000034377
Gene Nametubby like protein 4
Synonyms2210038L17Rik, 1110057P05Rik
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location6106437-6251128 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 6198708 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000120358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039655] [ENSMUST00000142030] [ENSMUST00000149756]
Predicted Effect probably damaging
Transcript: ENSMUST00000039655
AA Change: M194V

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049248
Gene: ENSMUSG00000034377
AA Change: M194V

DomainStartEndE-ValueType
WD40 71 110 2.49e-1 SMART
Blast:WD40 113 153 9e-21 BLAST
WD40 159 195 1.84e1 SMART
low complexity region 226 238 N/A INTRINSIC
Blast:WD40 275 306 8e-8 BLAST
Blast:WD40 330 371 1e-14 BLAST
SOCS_box 374 411 2.31e-1 SMART
SCOP:d1c8za_ 418 505 1e-18 SMART
low complexity region 509 518 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
SCOP:d1c8za_ 594 669 8e-12 SMART
low complexity region 770 789 N/A INTRINSIC
low complexity region 837 864 N/A INTRINSIC
low complexity region 1021 1026 N/A INTRINSIC
low complexity region 1041 1056 N/A INTRINSIC
low complexity region 1174 1181 N/A INTRINSIC
low complexity region 1188 1197 N/A INTRINSIC
Pfam:Tub 1346 1543 2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141059
Predicted Effect probably null
Transcript: ENSMUST00000142030
AA Change: M1V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120358
Gene: ENSMUSG00000034377
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000149756
AA Change: M1V

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123218
Gene: ENSMUSG00000034377
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Blast:WD40 82 113 6e-8 BLAST
Blast:WD40 137 178 1e-14 BLAST
SOCS_box 181 218 2.31e-1 SMART
SCOP:d1c8za_ 225 312 2e-18 SMART
low complexity region 316 325 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
SCOP:d1c8za_ 401 476 9e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 644 671 N/A INTRINSIC
low complexity region 828 833 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 981 988 N/A INTRINSIC
low complexity region 995 1004 N/A INTRINSIC
coiled coil region 1187 1215 N/A INTRINSIC
Pfam:Tub 1224 1350 5.3e-26 PFAM
Meta Mutation Damage Score 0.256 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgre4 T C 17: 55,802,218 probably benign Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cdc14b A G 13: 64,246,608 probably benign Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Epsti1 A T 14: 77,974,513 probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Fam84b A T 15: 60,823,447 V150E probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Trak1 C T 9: 121,451,734 probably benign Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Tulp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Tulp4 APN 17 6139076 missense probably damaging 0.97
IGL02503:Tulp4 APN 17 6213391 missense probably damaging 0.99
IGL03012:Tulp4 APN 17 6213379 splice site probably benign
IGL03219:Tulp4 APN 17 6139010 missense probably damaging 1.00
tuba_mirum UTSW 17 6201819 missense probably damaging 1.00
R0066:Tulp4 UTSW 17 6201733 missense probably damaging 0.99
R0066:Tulp4 UTSW 17 6201733 missense probably damaging 0.99
R0711:Tulp4 UTSW 17 6139112 missense possibly damaging 0.94
R1718:Tulp4 UTSW 17 6222440 missense probably benign 0.39
R1736:Tulp4 UTSW 17 6233215 missense possibly damaging 0.66
R1775:Tulp4 UTSW 17 6139046 missense probably damaging 0.96
R1793:Tulp4 UTSW 17 6139112 missense possibly damaging 0.94
R3160:Tulp4 UTSW 17 6198708 start codon destroyed probably null 0.94
R3431:Tulp4 UTSW 17 6206964 missense probably benign 0.03
R4081:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R4082:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R4610:Tulp4 UTSW 17 6198833 missense probably damaging 0.96
R4963:Tulp4 UTSW 17 6198813 missense probably damaging 1.00
R4966:Tulp4 UTSW 17 6198813 missense probably damaging 1.00
R5386:Tulp4 UTSW 17 6236293 missense probably damaging 1.00
R6019:Tulp4 UTSW 17 6233215 missense possibly damaging 0.66
R6275:Tulp4 UTSW 17 6198736 missense probably damaging 1.00
R6294:Tulp4 UTSW 17 6201819 missense probably damaging 1.00
R6587:Tulp4 UTSW 17 6231871 missense possibly damaging 0.62
R6680:Tulp4 UTSW 17 6139037 missense probably damaging 1.00
R7030:Tulp4 UTSW 17 6214666 missense probably damaging 1.00
R7068:Tulp4 UTSW 17 6185289 missense probably damaging 1.00
R7109:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7110:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7229:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7230:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7231:Tulp4 UTSW 17 6236235 missense probably benign 0.03
X0067:Tulp4 UTSW 17 6206923 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCTGCTGGTCACGTTTCAG -3'
(R):5'- TGTTCTCTTGCCAAATTCGATG -3'

Sequencing Primer
(F):5'- CATTATAGGGACTGTCTCCTGGAAC -3'
(R):5'- CTCTTGCCAAATTCGATGAAAGGG -3'
Posted On2015-03-25