Incidental Mutation 'R3162:Dennd1c'
ID271710
Institutional Source Beutler Lab
Gene Symbol Dennd1c
Ensembl Gene ENSMUSG00000002668
Gene NameDENN/MADD domain containing 1C
Synonyms4432409M07Rik
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location57066056-57078510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57066562 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 637 (G637D)
Ref Sequence ENSEMBL: ENSMUSP00000011623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011623] [ENSMUST00000071826] [ENSMUST00000097299] [ENSMUST00000163628] [ENSMUST00000163763] [ENSMUST00000169543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000011623
AA Change: G637D

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000011623
Gene: ENSMUSG00000002668
AA Change: G637D

DomainStartEndE-ValueType
uDENN 9 89 1.18e-22 SMART
DENN 90 293 3.95e-74 SMART
low complexity region 312 318 N/A INTRINSIC
dDENN 324 391 2.39e-18 SMART
low complexity region 560 579 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071826
SMART Domains Protein: ENSMUSP00000071729
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097299
SMART Domains Protein: ENSMUSP00000094902
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163628
SMART Domains Protein: ENSMUSP00000126402
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1fwxa1 30 52 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163763
SMART Domains Protein: ENSMUSP00000132502
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169543
SMART Domains Protein: ENSMUSP00000125760
Gene: ENSMUSG00000044279

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 50 72 N/A INTRINSIC
Meta Mutation Damage Score 0.1348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1C, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgre4 T C 17: 55,802,218 probably benign Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cdc14b A G 13: 64,246,608 probably benign Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Epsti1 A T 14: 77,974,513 probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Fam84b A T 15: 60,823,447 V150E probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Trak1 C T 9: 121,451,734 probably benign Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Dennd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Dennd1c APN 17 57066839 missense probably damaging 0.99
IGL02729:Dennd1c APN 17 57066637 missense probably benign 0.34
IGL03185:Dennd1c APN 17 57066803 missense probably benign 0.00
R0067:Dennd1c UTSW 17 57075465 missense probably damaging 1.00
R0067:Dennd1c UTSW 17 57075465 missense probably damaging 1.00
R0288:Dennd1c UTSW 17 57076870 splice site probably null
R0380:Dennd1c UTSW 17 57073822 missense probably damaging 1.00
R0381:Dennd1c UTSW 17 57073822 missense probably damaging 1.00
R0389:Dennd1c UTSW 17 57067649 missense probably benign 0.02
R1528:Dennd1c UTSW 17 57066935 missense probably benign
R1892:Dennd1c UTSW 17 57067083 missense probably benign 0.00
R1936:Dennd1c UTSW 17 57073889 splice site probably benign
R2216:Dennd1c UTSW 17 57074492 critical splice donor site probably null
R3021:Dennd1c UTSW 17 57074180 critical splice acceptor site probably null
R3160:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R3162:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R4133:Dennd1c UTSW 17 57076980 missense possibly damaging 0.53
R4831:Dennd1c UTSW 17 57066428 nonsense probably null
R4987:Dennd1c UTSW 17 57073852 missense probably damaging 0.98
R5417:Dennd1c UTSW 17 57066755 frame shift probably null
R5418:Dennd1c UTSW 17 57066755 frame shift probably null
R6241:Dennd1c UTSW 17 57066272 missense probably benign 0.00
R6259:Dennd1c UTSW 17 57067104 missense probably damaging 1.00
R6722:Dennd1c UTSW 17 57066802 missense probably benign
R7099:Dennd1c UTSW 17 57067915 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGACAGCATCAGAGTTGGG -3'
(R):5'- GTGAGAACTTCCTCTCTGCTAC -3'

Sequencing Primer
(F):5'- CCTAGTGGGGACTCTGAGGAG -3'
(R):5'- TGCTACCCCCTCCCCAC -3'
Posted On2015-03-25