Incidental Mutation 'R3425:Klf15'
ID271721
Institutional Source Beutler Lab
Gene Symbol Klf15
Ensembl Gene ENSMUSG00000030087
Gene NameKruppel-like factor 15
SynonymsKKLF, 1810013I09Rik, CKLF
MMRRC Submission 040643-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.831) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location90462576-90475238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90466820 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 126 (S126P)
Ref Sequence ENSEMBL: ENSMUSP00000144808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032174] [ENSMUST00000113530] [ENSMUST00000203039] [ENSMUST00000203607]
Predicted Effect probably benign
Transcript: ENSMUST00000032174
AA Change: S126P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000032174
Gene: ENSMUSG00000030087
AA Change: S126P

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113530
AA Change: S126P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109158
Gene: ENSMUSG00000030087
AA Change: S126P

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203039
AA Change: S126P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000144962
Gene: ENSMUSG00000030087
AA Change: S126P

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203607
AA Change: S126P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000144808
Gene: ENSMUSG00000030087
AA Change: S126P

DomainStartEndE-ValueType
low complexity region 87 100 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 192 211 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
ZnF_C2H2 320 344 1.26e-2 SMART
ZnF_C2H2 350 374 1.98e-4 SMART
ZnF_C2H2 380 402 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205136
Meta Mutation Damage Score 0.1588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display impaired gluconeogenesis with severe fasting induce hypoglycemia. Homozygotes are also more sensitive to induced cardiac stress and display mild cardiac and aortic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Mypn T C 10: 63,118,417 probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Klf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5443:Klf15 UTSW 6 90467360 missense possibly damaging 0.50
R5985:Klf15 UTSW 6 90466721 missense possibly damaging 0.69
R6171:Klf15 UTSW 6 90466619 missense possibly damaging 0.59
R6529:Klf15 UTSW 6 90467412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGACAGCGATGTCTCCAG -3'
(R):5'- CAGACTCTGGATGAAGGTGG -3'

Sequencing Primer
(F):5'- CTGTTCCTGCTACAGTGCGG -3'
(R):5'- CTCTGGATGAAGGTGGCTCCG -3'
Posted On2015-03-25