Incidental Mutation 'R3425:Mypn'
ID271726
Institutional Source Beutler Lab
Gene Symbol Mypn
Ensembl Gene ENSMUSG00000020067
Gene Namemyopalladin
Synonyms1110056A04Rik
MMRRC Submission 040643-MU
Accession Numbers

Genbank: NM_182992; MGI: 1916052

Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R3425 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63115795-63203952 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 63118417 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095580] [ENSMUST00000218978]
Predicted Effect probably benign
Transcript: ENSMUST00000095580
SMART Domains Protein: ENSMUSP00000093240
Gene: ENSMUSG00000020067

DomainStartEndE-ValueType
low complexity region 46 56 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
IGc2 279 346 2.16e-8 SMART
low complexity region 384 405 N/A INTRINSIC
IGc2 444 519 1.69e-10 SMART
low complexity region 636 648 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 721 741 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 826 838 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
IGc2 953 1022 1.64e-8 SMART
IGc2 1080 1148 3.67e-11 SMART
IG 1173 1259 1.17e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218978
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Striated muscle in vertebrates comprises large proteins which must be organized properly to contract efficiently. Z-lines in striated muscle are a sign of this organization, representing the ends of actin thin filaments, titin, nebulin or nebulette and accessory proteins required for structure and function. This gene encodes a protein which interacts with nebulin in skeletal muscle or nebulette in cardiac muscle and alpha-actinin. In addition, this gene product can interact with a protein with the I-band indicating it has a regulatory as well as structural function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(51) : Gene trapped(51)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5m1 A G 14: 49,073,683 E70G probably damaging Het
Atp8b3 T C 10: 80,536,347 E16G probably benign Het
Csmd3 A T 15: 47,847,252 D1646E probably damaging Het
Cyp2c70 G T 19: 40,184,024 A58E probably damaging Het
Ddx11 T C 17: 66,139,439 I415T possibly damaging Het
Gm8674 T A 13: 49,901,756 noncoding transcript Het
H2-T22 A C 17: 36,041,580 L151R probably damaging Het
Hmgcs1 C A 13: 119,705,132 P420Q probably damaging Het
Il16 T C 7: 83,644,040 E575G probably damaging Het
Ism2 T C 12: 87,287,097 N58S probably benign Het
Kat7 T C 11: 95,303,165 E103G probably damaging Het
Klf15 T C 6: 90,466,820 S126P probably benign Het
Mapt C T 11: 104,298,722 R189* probably null Het
Meltf C T 16: 31,896,525 R679* probably null Het
Myo1d T C 11: 80,601,638 T764A probably benign Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Ptpn4 T C 1: 119,707,830 D381G probably benign Het
Ros1 C A 10: 52,128,416 probably null Het
Scel T G 14: 103,608,106 V559G possibly damaging Het
Sez6l T C 5: 112,426,749 D875G probably damaging Het
Slc18b1 T G 10: 23,822,976 M348R probably damaging Het
Slc36a3 G T 11: 55,142,781 T137K probably benign Het
Slco4c1 A T 1: 96,841,251 S295R probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss15 A T 16: 79,003,433 N587K possibly damaging Het
Upp1 T C 11: 9,125,700 probably null Het
Zp1 G A 19: 10,918,592 R227W probably benign Het
Other mutations in Mypn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mypn APN 10 63192423 missense probably damaging 1.00
IGL01137:Mypn APN 10 63152854 missense probably benign 0.12
IGL01383:Mypn APN 10 63135797 missense probably damaging 1.00
IGL01560:Mypn APN 10 63134964 missense probably benign 0.27
IGL01569:Mypn APN 10 63127759 missense probably damaging 1.00
IGL02197:Mypn APN 10 63123278 missense possibly damaging 0.69
IGL02829:Mypn APN 10 63192586 missense probably benign 0.01
IGL03221:Mypn APN 10 63131123 missense probably damaging 1.00
IGL03377:Mypn APN 10 63192865 missense probably benign 0.01
2107:Mypn UTSW 10 63203751 utr 5 prime probably benign
PIT4576001:Mypn UTSW 10 63120071 missense probably damaging 1.00
R0115:Mypn UTSW 10 63192380 splice site probably benign
R0377:Mypn UTSW 10 63127622 unclassified probably benign
R0480:Mypn UTSW 10 63193203 missense probably benign 0.01
R0581:Mypn UTSW 10 63162244 missense probably benign 0.06
R0669:Mypn UTSW 10 63134923 splice site probably benign
R0822:Mypn UTSW 10 63169256 missense probably damaging 1.00
R1209:Mypn UTSW 10 63118499 missense probably damaging 1.00
R1401:Mypn UTSW 10 63152857 missense probably damaging 0.96
R1513:Mypn UTSW 10 63169368 missense probably damaging 0.99
R1750:Mypn UTSW 10 63136197 missense probably benign 0.01
R1780:Mypn UTSW 10 63121964 missense probably damaging 1.00
R1791:Mypn UTSW 10 63125693 missense probably damaging 0.97
R1859:Mypn UTSW 10 63146190 missense probably benign
R1903:Mypn UTSW 10 63123397 missense probably benign 0.06
R2275:Mypn UTSW 10 63131069 missense probably damaging 1.00
R2420:Mypn UTSW 10 63192869 nonsense probably null
R3767:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3768:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3770:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3777:Mypn UTSW 10 63147982 missense possibly damaging 0.92
R3785:Mypn UTSW 10 63193182 missense probably benign 0.43
R3888:Mypn UTSW 10 63192510 missense probably damaging 1.00
R4289:Mypn UTSW 10 63131182 missense probably damaging 1.00
R4301:Mypn UTSW 10 63118484 missense probably damaging 1.00
R4366:Mypn UTSW 10 63192708 missense probably benign 0.00
R4459:Mypn UTSW 10 63192432 missense probably damaging 1.00
R4921:Mypn UTSW 10 63147936 missense possibly damaging 0.75
R4995:Mypn UTSW 10 63119968 intron probably null
R5064:Mypn UTSW 10 63123371 missense possibly damaging 0.68
R5083:Mypn UTSW 10 63118528 missense probably damaging 0.98
R5108:Mypn UTSW 10 63136294 missense probably damaging 1.00
R5399:Mypn UTSW 10 63120186 missense probably benign 0.03
R5438:Mypn UTSW 10 63135839 nonsense probably null
R5590:Mypn UTSW 10 63120048 missense probably benign 0.27
R5652:Mypn UTSW 10 63135801 missense probably damaging 1.00
R5717:Mypn UTSW 10 63127776 missense probably damaging 1.00
R5970:Mypn UTSW 10 63131023 missense probably benign 0.36
R6616:Mypn UTSW 10 63169312 missense probably damaging 1.00
R6930:Mypn UTSW 10 63116939 missense probably damaging 1.00
R6987:Mypn UTSW 10 63193131 missense probably benign 0.00
R7020:Mypn UTSW 10 63192510 missense probably damaging 1.00
R7081:Mypn UTSW 10 63134958 missense probably damaging 1.00
R7477:Mypn UTSW 10 63125721 missense possibly damaging 0.89
R7534:Mypn UTSW 10 63193131 missense probably benign 0.00
X0022:Mypn UTSW 10 63136063 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGCAGTCTGACCACTTG -3'
(R):5'- CTCCTCAAAGAGTTTCCCCAAG -3'

Sequencing Primer
(F):5'- AAGCAGTCTGACCACTTGATTCTC -3'
(R):5'- TCTGCTCCCGAGTTAAAGGTGAATC -3'
Posted On2015-03-25