Incidental Mutation 'R3706:Pigc'
ID271752
Institutional Source Beutler Lab
Gene Symbol Pigc
Ensembl Gene ENSMUSG00000026698
Gene Namephosphatidylinositol glycan anchor biosynthesis, class C
Synonyms3110030E07Rik
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location161969186-161973435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 161971094 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 215 (M215K)
Ref Sequence ENSEMBL: ENSMUSP00000141646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028021] [ENSMUST00000111594] [ENSMUST00000159648] [ENSMUST00000160881] [ENSMUST00000162676] [ENSMUST00000193784]
Predicted Effect probably benign
Transcript: ENSMUST00000028021
AA Change: M215K

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028021
Gene: ENSMUSG00000026698
AA Change: M215K

DomainStartEndE-ValueType
Pfam:GPI2 14 284 6.2e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111594
AA Change: M215K

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107221
Gene: ENSMUSG00000026698
AA Change: M215K

DomainStartEndE-ValueType
Pfam:GPI2 14 284 1.7e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141397
Predicted Effect probably benign
Transcript: ENSMUST00000159648
Predicted Effect probably benign
Transcript: ENSMUST00000160881
SMART Domains Protein: ENSMUSP00000125321
Gene: ENSMUSG00000026698

DomainStartEndE-ValueType
Pfam:GPI2 14 140 2.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161826
Predicted Effect probably benign
Transcript: ENSMUST00000162676
SMART Domains Protein: ENSMUSP00000124751
Gene: ENSMUSG00000086277

DomainStartEndE-ValueType
Pfam:DUF4548 17 181 1.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193784
AA Change: M215K

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141646
Gene: ENSMUSG00000026698
AA Change: M215K

DomainStartEndE-ValueType
Pfam:GPI2 14 284 1.7e-94 PFAM
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum associated protein that is involved in glycosylphosphatidylinositol (GPI) lipid anchor biosynthesis. The GPI lipid anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. The encoded protein is one subunit of the GPI N-acetylglucosaminyl (GlcNAc) transferase that transfers GlcNAc to phosphatidylinositol (PI) on the cytoplasmic side of the endoplasmic reticulum. Two alternatively spliced transcripts that encode the same protein have been found for this gene. A pseudogene on chromosome 11 has also been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Pigc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01725:Pigc APN 1 161971345 utr 3 prime probably benign
IGL02009:Pigc APN 1 161970565 missense probably damaging 1.00
IGL02586:Pigc APN 1 161970934 missense probably benign 0.02
IGL03095:Pigc APN 1 161970776 missense possibly damaging 0.79
IGL03109:Pigc APN 1 161970776 missense possibly damaging 0.79
apocryphon UTSW 1 161971094 missense probably benign 0.21
pistis UTSW 1 161970947 missense probably damaging 0.99
R0321:Pigc UTSW 1 161971099 nonsense probably null
R1450:Pigc UTSW 1 161971253 missense probably benign 0.01
R1708:Pigc UTSW 1 161970724 missense probably benign 0.00
R1857:Pigc UTSW 1 161970877 missense possibly damaging 0.90
R1875:Pigc UTSW 1 161970947 missense probably damaging 0.99
R2371:Pigc UTSW 1 161971010 missense possibly damaging 0.72
R2940:Pigc UTSW 1 161970670 missense possibly damaging 0.96
R3707:Pigc UTSW 1 161971094 missense probably benign 0.21
R3708:Pigc UTSW 1 161971094 missense probably benign 0.21
R3725:Pigc UTSW 1 161971291 missense possibly damaging 0.95
R5193:Pigc UTSW 1 161970896 missense possibly damaging 0.91
R5682:Pigc UTSW 1 161970947 missense probably damaging 0.99
R6228:Pigc UTSW 1 161970467 missense probably benign 0.03
R7143:Pigc UTSW 1 161970592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCATGGCAGTCTTTATGC -3'
(R):5'- CCAAGGCCCGTGAATATTTTC -3'

Sequencing Primer
(F):5'- GCAGTCTTTATGCTGTTAGGCCATC -3'
(R):5'- GCCCGTGAATATTTTCCTTAAAAAGC -3'
Posted On2015-03-25