Incidental Mutation 'R3706:Atxn2'
ID271766
Institutional Source Beutler Lab
Gene Symbol Atxn2
Ensembl Gene ENSMUSG00000042605
Gene Nameataxin 2
Synonyms9630045M23Rik, ATX2, Sca2
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121711337-121816493 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121785868 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051950] [ENSMUST00000161064] [ENSMUST00000162327] [ENSMUST00000225761]
Predicted Effect probably null
Transcript: ENSMUST00000051950
SMART Domains Protein: ENSMUSP00000056715
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 32 42 N/A INTRINSIC
low complexity region 46 69 N/A INTRINSIC
low complexity region 93 116 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 168 219 N/A INTRINSIC
Pfam:SM-ATX 236 307 6.4e-23 PFAM
LsmAD 378 446 8.57e-25 SMART
low complexity region 520 540 N/A INTRINSIC
low complexity region 544 576 N/A INTRINSIC
low complexity region 685 705 N/A INTRINSIC
low complexity region 807 838 N/A INTRINSIC
low complexity region 864 879 N/A INTRINSIC
Pfam:PAM2 880 897 5.7e-9 PFAM
low complexity region 1128 1165 N/A INTRINSIC
low complexity region 1185 1196 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159828
Predicted Effect probably null
Transcript: ENSMUST00000160821
SMART Domains Protein: ENSMUSP00000125647
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
Pfam:LsmAD 1 47 3.6e-11 PFAM
low complexity region 217 237 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161064
SMART Domains Protein: ENSMUSP00000124070
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
LsmAD 69 137 8.57e-25 SMART
low complexity region 211 231 N/A INTRINSIC
low complexity region 235 267 N/A INTRINSIC
low complexity region 376 396 N/A INTRINSIC
low complexity region 498 529 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Pfam:PAM2 571 588 3.5e-9 PFAM
low complexity region 801 838 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
low complexity region 915 923 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162327
SMART Domains Protein: ENSMUSP00000123784
Gene: ENSMUSG00000042605

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:PAM2 74 91 1.3e-9 PFAM
low complexity region 302 339 N/A INTRINSIC
low complexity region 359 370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200499
Predicted Effect probably benign
Transcript: ENSMUST00000225761
Meta Mutation Damage Score 0.586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of genes that is associated with microsatellite-expansion diseases, a class of neurological and neuromuscular disorders caused by expansion of short stretches of repetitive DNA. The protein encoded by this gene has two globular domains near the N-terminus, one of which contains a clathrin-mediated trans-Golgi signal and an endoplasmic reticulum exit signal. The encoded cytoplasmic protein localizes to the endoplasmic reticulum and plasma membrane, is involved in endocytosis, and modulates mTOR signals, modifying ribosomal translation and mitochondrial function. The N-terminal region of the protein contains a polyglutamine tract of 14-31 residues that can be expanded in the pathogenic state to 32-200 residues. Intermediate length expansions of this tract increase susceptibility to amyotrophic lateral sclerosis, while long expansions of this tract result in spinocerebellar ataxia-2, an autosomal-dominantly inherited, neurodegenerative disorder. Genome-wide association studies indicate that loss-of-function mutations in this gene may be associated with susceptibility to type I diabetes, obesity and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mice exhibit an enlarged fat pad, hepatic steatosis and enlarged seminal vesicles. A mild defect in motor learning is seen, but no other notable behavioral or neurological defects are detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Atxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Atxn2 APN 5 121795055 missense probably benign 0.00
IGL00798:Atxn2 APN 5 121795235 missense possibly damaging 0.58
IGL01518:Atxn2 APN 5 121810979 missense probably damaging 1.00
IGL01737:Atxn2 APN 5 121797344 missense probably damaging 0.98
IGL01832:Atxn2 APN 5 121806268 nonsense probably null
IGL02122:Atxn2 APN 5 121778030 missense probably damaging 1.00
IGL02333:Atxn2 APN 5 121781387 missense probably damaging 1.00
IGL02742:Atxn2 APN 5 121781336 missense possibly damaging 0.75
IGL03028:Atxn2 APN 5 121810909 missense probably damaging 1.00
IGL03282:Atxn2 APN 5 121785235 missense probably benign 0.00
R0387:Atxn2 UTSW 5 121802143 missense possibly damaging 0.83
R0653:Atxn2 UTSW 5 121772778 missense probably damaging 0.99
R0849:Atxn2 UTSW 5 121747421 unclassified probably null
R1305:Atxn2 UTSW 5 121749184 missense probably damaging 1.00
R1440:Atxn2 UTSW 5 121803082 critical splice donor site probably null
R1471:Atxn2 UTSW 5 121786374 missense probably damaging 1.00
R1521:Atxn2 UTSW 5 121779591 missense probably damaging 1.00
R1528:Atxn2 UTSW 5 121802108 missense probably damaging 0.99
R1528:Atxn2 UTSW 5 121813530 missense probably damaging 1.00
R2083:Atxn2 UTSW 5 121784006 missense probably benign 0.00
R2197:Atxn2 UTSW 5 121806217 splice site probably null
R2217:Atxn2 UTSW 5 121803077 missense probably damaging 1.00
R2218:Atxn2 UTSW 5 121803077 missense probably damaging 1.00
R2420:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2421:Atxn2 UTSW 5 121802079 critical splice acceptor site probably null
R2510:Atxn2 UTSW 5 121781393 missense probably damaging 1.00
R4604:Atxn2 UTSW 5 121781343 missense probably damaging 1.00
R4852:Atxn2 UTSW 5 121814411 missense probably damaging 0.97
R4914:Atxn2 UTSW 5 121749096 missense probably damaging 1.00
R4982:Atxn2 UTSW 5 121814343 missense possibly damaging 0.66
R5172:Atxn2 UTSW 5 121795035 unclassified probably null
R5213:Atxn2 UTSW 5 121814480 unclassified probably null
R5655:Atxn2 UTSW 5 121747426 missense probably damaging 0.97
R5775:Atxn2 UTSW 5 121813449 missense probably damaging 1.00
R5782:Atxn2 UTSW 5 121797310 missense probably damaging 1.00
R6015:Atxn2 UTSW 5 121810992 missense probably damaging 1.00
R6438:Atxn2 UTSW 5 121779432 missense probably damaging 1.00
R6529:Atxn2 UTSW 5 121811614 critical splice donor site probably null
R6659:Atxn2 UTSW 5 121777964 missense probably benign 0.10
R6864:Atxn2 UTSW 5 121779494 missense probably damaging 1.00
R7035:Atxn2 UTSW 5 121811467 nonsense probably null
X0028:Atxn2 UTSW 5 121802083 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCAGAAGGTTAGAAGTGTTTG -3'
(R):5'- TCTGTCTGGCTAAACACTTTGC -3'

Sequencing Primer
(F):5'- AGAAGTGTTTGGTATTTACTCACAC -3'
(R):5'- CTCAGTGGGTAAGAGCACC -3'
Posted On2015-03-25