Incidental Mutation 'R3706:Fgfr2'
ID271772
Institutional Source Beutler Lab
Gene Symbol Fgfr2
Ensembl Gene ENSMUSG00000030849
Gene Namefibroblast growth factor receptor 2
SynonymsFgfr-2, KGFRTr, Bek, Fgfr7, Fgfr-7, svs
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130162451-133123350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130198431 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 358 (T358A)
Ref Sequence ENSEMBL: ENSMUSP00000113010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117073] [ENSMUST00000117089] [ENSMUST00000117357] [ENSMUST00000117691] [ENSMUST00000117754] [ENSMUST00000117858] [ENSMUST00000117872] [ENSMUST00000118296] [ENSMUST00000119260] [ENSMUST00000120141] [ENSMUST00000120187] [ENSMUST00000120715] [ENSMUST00000121064] [ENSMUST00000121080] [ENSMUST00000122054] [ENSMUST00000122448] [ENSMUST00000124096] [ENSMUST00000153166]
Predicted Effect probably benign
Transcript: ENSMUST00000117073
AA Change: T243A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000112672
Gene: ENSMUSG00000030849
AA Change: T243A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 234 7.41e-7 SMART
transmembrane domain 260 282 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
TyrKc 364 640 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117089
SMART Domains Protein: ENSMUSP00000112992
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 430 439 N/A INTRINSIC
TyrKc 480 756 4.38e-152 SMART
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117357
SMART Domains Protein: ENSMUSP00000112580
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
low complexity region 669 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117691
SMART Domains Protein: ENSMUSP00000113180
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
low complexity region 786 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117754
AA Change: T145A

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113187
Gene: ENSMUSG00000030849
AA Change: T145A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 136 7.41e-7 SMART
transmembrane domain 162 184 N/A INTRINSIC
low complexity region 218 227 N/A INTRINSIC
TyrKc 268 544 4.38e-152 SMART
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117858
SMART Domains Protein: ENSMUSP00000112623
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117872
AA Change: T262A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113994
Gene: ENSMUSG00000030849
AA Change: T262A

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 253 7.41e-7 SMART
transmembrane domain 279 301 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
TyrKc 383 659 4.38e-152 SMART
low complexity region 687 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118296
SMART Domains Protein: ENSMUSP00000112471
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 343 352 N/A INTRINSIC
TyrKc 393 669 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119260
AA Change: T358A

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113010
Gene: ENSMUSG00000030849
AA Change: T358A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 349 7.41e-7 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
TyrKc 479 755 4.38e-152 SMART
low complexity region 783 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120141
SMART Domains Protein: ENSMUSP00000113415
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
TyrKc 391 667 4.38e-152 SMART
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120187
SMART Domains Protein: ENSMUSP00000113248
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 251 1.9e-4 SMART
transmembrane domain 280 302 N/A INTRINSIC
low complexity region 336 345 N/A INTRINSIC
TyrKc 386 662 4.38e-152 SMART
low complexity region 690 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120715
SMART Domains Protein: ENSMUSP00000113474
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 319 328 N/A INTRINSIC
TyrKc 369 645 4.38e-152 SMART
low complexity region 673 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121064
SMART Domains Protein: ENSMUSP00000113452
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 134 1.9e-4 SMART
transmembrane domain 163 185 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
TyrKc 269 545 4.38e-152 SMART
low complexity region 573 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121080
SMART Domains Protein: ENSMUSP00000112585
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 317 326 N/A INTRINSIC
TyrKc 367 643 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122054
AA Change: T377A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112430
Gene: ENSMUSG00000030849
AA Change: T377A

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
IGc2 288 368 7.41e-7 SMART
transmembrane domain 394 416 N/A INTRINSIC
low complexity region 450 459 N/A INTRINSIC
TyrKc 500 776 4.38e-152 SMART
low complexity region 804 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122448
SMART Domains Protein: ENSMUSP00000113993
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127091
SMART Domains Protein: ENSMUSP00000122856
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:I-set 3 56 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148675
Predicted Effect probably benign
Transcript: ENSMUST00000153166
SMART Domains Protein: ENSMUSP00000120100
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
SCOP:d1ev2e1 269 311 1e-5 SMART
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for null mutations die as embryos. Isoform IIIb deficient mutants die at birth with defects in multiple organs and tissues. Isoform IIIc deficient mutants have defects in osteoblast and chondrocyte lineages, producing dwarfism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Fgfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Fgfr2 APN 7 130167711 missense probably benign 0.45
IGL00594:Fgfr2 APN 7 130228723 missense probably damaging 1.00
IGL00963:Fgfr2 APN 7 130228761 missense probably damaging 0.99
IGL01968:Fgfr2 APN 7 130185248 missense probably damaging 1.00
IGL02003:Fgfr2 APN 7 130219072 missense probably damaging 1.00
IGL02063:Fgfr2 APN 7 130167755 missense probably damaging 1.00
IGL02239:Fgfr2 APN 7 130177686 missense probably damaging 1.00
IGL02349:Fgfr2 APN 7 130242606 missense probably damaging 1.00
IGL02630:Fgfr2 APN 7 130228795 splice site probably null
IGL02639:Fgfr2 APN 7 130228802 splice site probably benign
IGL03058:Fgfr2 APN 7 130182692 missense probably damaging 1.00
IGL03263:Fgfr2 APN 7 130180419 missense probably benign 0.12
IGL03377:Fgfr2 APN 7 130198517 missense probably damaging 0.98
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0078:Fgfr2 UTSW 7 130201075 missense possibly damaging 0.95
R0085:Fgfr2 UTSW 7 130196263 missense probably damaging 0.99
R0278:Fgfr2 UTSW 7 130261862 unclassified probably null
R0335:Fgfr2 UTSW 7 130196249 missense probably benign 0.00
R0557:Fgfr2 UTSW 7 130219081 missense probably damaging 1.00
R0631:Fgfr2 UTSW 7 130227239 intron probably benign
R0637:Fgfr2 UTSW 7 130171624 missense possibly damaging 0.89
R0841:Fgfr2 UTSW 7 130261905 missense probably benign 0.03
R0841:Fgfr2 UTSW 7 130772007 unclassified probably benign
R1646:Fgfr2 UTSW 7 130242644 missense probably damaging 1.00
R1670:Fgfr2 UTSW 7 130180457 missense probably damaging 1.00
R1678:Fgfr2 UTSW 7 130228620 splice site probably null
R1950:Fgfr2 UTSW 7 130198481 missense probably damaging 0.96
R2393:Fgfr2 UTSW 7 130227238 intron probably null
R3717:Fgfr2 UTSW 7 130182757 missense probably damaging 1.00
R3808:Fgfr2 UTSW 7 130199848 missense probably benign 0.01
R3945:Fgfr2 UTSW 7 130177755 missense possibly damaging 0.71
R4438:Fgfr2 UTSW 7 130172930 nonsense probably null
R4718:Fgfr2 UTSW 7 130261788 missense probably damaging 1.00
R4779:Fgfr2 UTSW 7 130185193 intron probably benign
R4925:Fgfr2 UTSW 7 130185272 missense probably damaging 1.00
R4932:Fgfr2 UTSW 7 130241277 missense probably damaging 1.00
R4941:Fgfr2 UTSW 7 130198445 missense probably benign 0.21
R4980:Fgfr2 UTSW 7 130201080 missense probably damaging 1.00
R5304:Fgfr2 UTSW 7 130167774 missense probably damaging 1.00
R5313:Fgfr2 UTSW 7 130241240 missense probably benign 0.01
R5375:Fgfr2 UTSW 7 130241215 missense possibly damaging 0.65
R5652:Fgfr2 UTSW 7 130261863 missense probably damaging 1.00
R6120:Fgfr2 UTSW 7 130228690 missense probably benign 0.24
R6347:Fgfr2 UTSW 7 130261757 missense probably damaging 1.00
R6375:Fgfr2 UTSW 7 130167745 missense probably damaging 1.00
R6475:Fgfr2 UTSW 7 130201120 missense probably benign 0.03
R6481:Fgfr2 UTSW 7 130185278 missense possibly damaging 0.85
R6494:Fgfr2 UTSW 7 130198550 missense probably damaging 1.00
R6542:Fgfr2 UTSW 7 130201123 missense probably benign 0.02
X0024:Fgfr2 UTSW 7 130185329 missense probably damaging 0.99
Z1088:Fgfr2 UTSW 7 130169799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCGTGCATGAATGTCTAAGG -3'
(R):5'- AATCTCCTGATGGCCAGCAC -3'

Sequencing Primer
(F):5'- CGTGCATGAATGTCTAAGGTTGTTTC -3'
(R):5'- ACGAGGCCTCTTGGTTCCAAG -3'
Posted On2015-03-25