Incidental Mutation 'R3706:Glb1l2'
ID271776
Institutional Source Beutler Lab
Gene Symbol Glb1l2
Ensembl Gene ENSMUSG00000036395
Gene Namegalactosidase, beta 1-like 2
Synonyms
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location26763044-26806468 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 26771020 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040398] [ENSMUST00000066560] [ENSMUST00000162252] [ENSMUST00000162702]
Predicted Effect probably benign
Transcript: ENSMUST00000040398
SMART Domains Protein: ENSMUSP00000047128
Gene: ENSMUSG00000036395

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_hydro_35 52 384 6.6e-118 PFAM
Pfam:Glyco_hydro_42 84 243 6.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066560
SMART Domains Protein: ENSMUSP00000066770
Gene: ENSMUSG00000036395

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Glyco_hydro_35 53 368 6.3e-121 PFAM
Pfam:Glyco_hydro_42 68 227 6.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161635
Predicted Effect probably benign
Transcript: ENSMUST00000162252
SMART Domains Protein: ENSMUSP00000124415
Gene: ENSMUSG00000036395

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
Pfam:Glyco_hydro_35 60 375 5.3e-121 PFAM
Pfam:Glyco_hydro_42 75 234 5.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162702
SMART Domains Protein: ENSMUSP00000125022
Gene: ENSMUSG00000036395

DomainStartEndE-ValueType
Pfam:Glyco_hydro_35 27 247 1.4e-67 PFAM
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Homozygous mutant mice show decreased mean white blood cell and lymphocyte counts and a decreased mean percentage of natural killer cells. Male mutant mice exhibit impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Glb1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Glb1l2 APN 9 26768418 critical splice donor site probably null
IGL02045:Glb1l2 APN 9 26796545 missense probably benign 0.00
IGL02172:Glb1l2 APN 9 26769086 missense probably damaging 0.98
IGL02372:Glb1l2 APN 9 26796476 missense probably damaging 1.00
IGL02831:Glb1l2 APN 9 26767450 missense probably benign 0.00
IGL03057:Glb1l2 APN 9 26806290 splice site probably benign
IGL03101:Glb1l2 APN 9 26765125 missense probably damaging 1.00
IGL03348:Glb1l2 APN 9 26765680 missense probably benign
P4717OSA:Glb1l2 UTSW 9 26766021 missense probably damaging 1.00
PIT4362001:Glb1l2 UTSW 9 26773981 missense probably benign 0.05
R0219:Glb1l2 UTSW 9 26806322 missense probably benign 0.33
R0414:Glb1l2 UTSW 9 26765104 nonsense probably null
R0418:Glb1l2 UTSW 9 26794101 missense probably damaging 1.00
R0791:Glb1l2 UTSW 9 26769751 missense possibly damaging 0.96
R1165:Glb1l2 UTSW 9 26794101 missense probably damaging 1.00
R1514:Glb1l2 UTSW 9 26769124 splice site probably benign
R1589:Glb1l2 UTSW 9 26769038 nonsense probably null
R1926:Glb1l2 UTSW 9 26771066 missense probably damaging 0.96
R2928:Glb1l2 UTSW 9 26768426 missense probably benign 0.10
R3441:Glb1l2 UTSW 9 26780742 missense probably damaging 1.00
R3442:Glb1l2 UTSW 9 26780742 missense probably damaging 1.00
R3814:Glb1l2 UTSW 9 26771034 missense probably benign 0.00
R5079:Glb1l2 UTSW 9 26771109 missense probably benign
R5308:Glb1l2 UTSW 9 26764759 missense probably damaging 1.00
R5310:Glb1l2 UTSW 9 26796866 intron probably benign
R5746:Glb1l2 UTSW 9 26796790 missense probably benign 0.01
R5969:Glb1l2 UTSW 9 26780742 missense probably damaging 1.00
R5998:Glb1l2 UTSW 9 26766003 missense possibly damaging 0.68
R6249:Glb1l2 UTSW 9 26765554 intron probably benign
R6284:Glb1l2 UTSW 9 26767448 missense probably benign 0.01
R6469:Glb1l2 UTSW 9 26796532 missense probably benign 0.03
R7054:Glb1l2 UTSW 9 26765127 missense probably null 0.51
X0020:Glb1l2 UTSW 9 26767733 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCTTGTTCTGGACTCAGGGAC -3'
(R):5'- TGCACCTATCAGCCTCTCAG -3'

Sequencing Primer
(F):5'- TCTGGACTCAGGGACTTTTATTTC -3'
(R):5'- CTCTCAGGCAAGGGGTAGAC -3'
Posted On2015-03-25