Incidental Mutation 'R3764:Hjurp'
ID271794
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene NameHolliday junction recognition protein
Synonyms
MMRRC Submission 040741-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R3764 (G1)
Quality Score217
Status Validated
Chromosome1
Chromosomal Location88262471-88277633 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) GT to GTT at 88266524 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
Predicted Effect probably null
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn G A 17: 13,846,589 A648T probably benign Het
Cadm3 C T 1: 173,346,497 V50I probably damaging Het
Cubn T A 2: 13,331,585 I2477F possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Eif4e3 C T 6: 99,640,625 R95Q probably damaging Het
Fam57b T C 7: 126,827,513 I36T probably damaging Het
Fmo5 T C 3: 97,645,717 I327T probably damaging Het
Gckr T A 5: 31,326,498 probably benign Het
Ghrhr T C 6: 55,380,771 V129A probably damaging Het
Gm16432 A T 1: 178,113,132 T687S unknown Het
Gm17689 A T 9: 36,581,818 probably null Het
Gsdma A T 11: 98,670,767 N191I probably damaging Het
Hadha T C 5: 30,144,209 K135E probably damaging Het
Lrp2 T C 2: 69,496,336 E1797G probably damaging Het
Ly9 T C 1: 171,594,144 Y513C possibly damaging Het
Nphp4 C T 4: 152,538,017 probably benign Het
Pcm1 A G 8: 41,330,882 E2005G probably damaging Het
Spsb2 T C 6: 124,809,555 Y84H probably damaging Het
Try10 C T 6: 41,356,524 R68C probably benign Het
Ube3c ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 29,637,586 probably benign Het
Vps50 A T 6: 3,588,063 I679F probably damaging Het
Wdr81 G A 11: 75,452,803 T546I probably damaging Het
Zcchc6 T A 13: 59,800,380 E307V probably damaging Het
Zfp40 T A 17: 23,177,127 H94L possibly damaging Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5457:Hjurp UTSW 1 88266525 frame shift probably null
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- AACTGTCATGGTTTGTGATGCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'
Posted On2015-03-25