Incidental Mutation 'R3764:Ube3c'
ID271803
Institutional Source Beutler Lab
Gene Symbol Ube3c
Ensembl Gene ENSMUSG00000039000
Gene Nameubiquitin protein ligase E3C
Synonyms
MMRRC Submission 040741-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R3764 (G1)
Quality Score166
Status Validated
Chromosome5
Chromosomal Location29569242-29676092 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT to ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT at 29637586 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049453]
Predicted Effect probably benign
Transcript: ENSMUST00000049453
SMART Domains Protein: ENSMUSP00000045998
Gene: ENSMUSG00000039000

DomainStartEndE-ValueType
IQ 44 66 1.68e-3 SMART
low complexity region 363 376 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Blast:HECTc 645 701 5e-25 BLAST
HECTc 742 1083 8.54e-178 SMART
Meta Mutation Damage Score 0.1464 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn G A 17: 13,846,589 A648T probably benign Het
Cadm3 C T 1: 173,346,497 V50I probably damaging Het
Cubn T A 2: 13,331,585 I2477F possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Eif4e3 C T 6: 99,640,625 R95Q probably damaging Het
Fam57b T C 7: 126,827,513 I36T probably damaging Het
Fmo5 T C 3: 97,645,717 I327T probably damaging Het
Gckr T A 5: 31,326,498 probably benign Het
Ghrhr T C 6: 55,380,771 V129A probably damaging Het
Gm16432 A T 1: 178,113,132 T687S unknown Het
Gm17689 A T 9: 36,581,818 probably null Het
Gsdma A T 11: 98,670,767 N191I probably damaging Het
Hadha T C 5: 30,144,209 K135E probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lrp2 T C 2: 69,496,336 E1797G probably damaging Het
Ly9 T C 1: 171,594,144 Y513C possibly damaging Het
Nphp4 C T 4: 152,538,017 probably benign Het
Pcm1 A G 8: 41,330,882 E2005G probably damaging Het
Spsb2 T C 6: 124,809,555 Y84H probably damaging Het
Try10 C T 6: 41,356,524 R68C probably benign Het
Vps50 A T 6: 3,588,063 I679F probably damaging Het
Wdr81 G A 11: 75,452,803 T546I probably damaging Het
Zcchc6 T A 13: 59,800,380 E307V probably damaging Het
Zfp40 T A 17: 23,177,127 H94L possibly damaging Het
Other mutations in Ube3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Ube3c APN 5 29619229 missense probably damaging 1.00
IGL01526:Ube3c APN 5 29667962 missense probably damaging 0.99
IGL01901:Ube3c APN 5 29668007 missense probably damaging 1.00
IGL02029:Ube3c APN 5 29619328 missense probably damaging 1.00
IGL02893:Ube3c APN 5 29632763 missense probably damaging 1.00
IGL03400:Ube3c APN 5 29601347 missense probably benign 0.00
lord_business UTSW 5 29637586 splice site probably benign
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0099:Ube3c UTSW 5 29607064 missense probably damaging 1.00
R0606:Ube3c UTSW 5 29590928 missense probably damaging 1.00
R0755:Ube3c UTSW 5 29637742 missense probably damaging 1.00
R0900:Ube3c UTSW 5 29601346 missense probably benign 0.00
R1624:Ube3c UTSW 5 29646619 missense probably benign 0.00
R1701:Ube3c UTSW 5 29601202 missense probably benign
R1918:Ube3c UTSW 5 29587317 missense probably damaging 1.00
R1933:Ube3c UTSW 5 29619659 missense probably damaging 0.97
R2072:Ube3c UTSW 5 29635640 missense probably benign 0.02
R2095:Ube3c UTSW 5 29668040 missense probably damaging 1.00
R2122:Ube3c UTSW 5 29619606 missense probably benign 0.14
R2962:Ube3c UTSW 5 29658418 missense possibly damaging 0.81
R3605:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3606:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3940:Ube3c UTSW 5 29619360 missense probably benign 0.31
R4776:Ube3c UTSW 5 29632838 critical splice donor site probably null
R4794:Ube3c UTSW 5 29597085 missense probably benign 0.06
R4924:Ube3c UTSW 5 29631271 missense possibly damaging 0.56
R5059:Ube3c UTSW 5 29631295 missense probably null 0.11
R5068:Ube3c UTSW 5 29601354 critical splice donor site probably null
R5140:Ube3c UTSW 5 29635711 missense probably damaging 1.00
R5849:Ube3c UTSW 5 29658409 missense probably damaging 1.00
R5890:Ube3c UTSW 5 29658292 missense possibly damaging 0.77
R5956:Ube3c UTSW 5 29599056 intron probably benign
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6264:Ube3c UTSW 5 29590831 missense probably damaging 1.00
R6354:Ube3c UTSW 5 29663583 missense probably damaging 0.99
R6658:Ube3c UTSW 5 29602217 missense probably damaging 1.00
R6877:Ube3c UTSW 5 29587318 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AACACGTACTATGACATGGGTC -3'
(R):5'- CTGGAGAAAGTTTGTCATAAGCATC -3'

Sequencing Primer
(F):5'- GACATGGGTCTTTCAAAGCTTACTG -3'
(R):5'- ACCATCGCCTTGAACTTC -3'
Posted On2015-03-25