Incidental Mutation 'R3764:Gm17689'
ID271815
Institutional Source Beutler Lab
Gene Symbol Gm17689
Ensembl Gene ENSMUSG00000091248
Gene Namepredicted gene, 17689
Synonyms
MMRRC Submission 040741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3764 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location36581278-36582635 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 36581818 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126891 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000170030
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.3%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn G A 17: 13,846,589 A648T probably benign Het
Cadm3 C T 1: 173,346,497 V50I probably damaging Het
Cubn T A 2: 13,331,585 I2477F possibly damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Eif4e3 C T 6: 99,640,625 R95Q probably damaging Het
Fam57b T C 7: 126,827,513 I36T probably damaging Het
Fmo5 T C 3: 97,645,717 I327T probably damaging Het
Gckr T A 5: 31,326,498 probably benign Het
Ghrhr T C 6: 55,380,771 V129A probably damaging Het
Gm16432 A T 1: 178,113,132 T687S unknown Het
Gsdma A T 11: 98,670,767 N191I probably damaging Het
Hadha T C 5: 30,144,209 K135E probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lrp2 T C 2: 69,496,336 E1797G probably damaging Het
Ly9 T C 1: 171,594,144 Y513C possibly damaging Het
Nphp4 C T 4: 152,538,017 probably benign Het
Pcm1 A G 8: 41,330,882 E2005G probably damaging Het
Spsb2 T C 6: 124,809,555 Y84H probably damaging Het
Try10 C T 6: 41,356,524 R68C probably benign Het
Ube3c ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT ACTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 29,637,586 probably benign Het
Vps50 A T 6: 3,588,063 I679F probably damaging Het
Wdr81 G A 11: 75,452,803 T546I probably damaging Het
Zcchc6 T A 13: 59,800,380 E307V probably damaging Het
Zfp40 T A 17: 23,177,127 H94L possibly damaging Het
Other mutations in Gm17689
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Gm17689 APN 9 36581363 missense probably benign 0.00
IGL01693:Gm17689 APN 9 36581366 missense probably benign 0.31
IGL02268:Gm17689 APN 9 36581870 missense possibly damaging 0.71
IGL03191:Gm17689 APN 9 36581402 missense probably benign 0.00
PIT4354001:Gm17689 UTSW 9 36581301 missense possibly damaging 0.71
R0401:Gm17689 UTSW 9 36582628 missense unknown
R0743:Gm17689 UTSW 9 36581301 missense probably benign 0.03
R1483:Gm17689 UTSW 9 36581324 missense probably benign 0.00
R1701:Gm17689 UTSW 9 36581818 critical splice donor site probably benign
R2258:Gm17689 UTSW 9 36581865 missense probably benign 0.03
R5143:Gm17689 UTSW 9 36581904 missense probably benign 0.31
R6783:Gm17689 UTSW 9 36581335 synonymous probably null
R7013:Gm17689 UTSW 9 36582558 missense unknown
R7014:Gm17689 UTSW 9 36582558 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCTCTTAGATAGCCATGAATACCAC -3'
(R):5'- ATGCTTGAAGCCGACCTTGAG -3'

Sequencing Primer
(F):5'- GCCATGAATACCACTAAAAGAACCTG -3'
(R):5'- GCTTGAAGCCGACCTTGAGTAAAC -3'
Posted On2015-03-25