Incidental Mutation 'R3777:Fmn1'
ID271827
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R3777 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113365122 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 389 (E389G)
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect unknown
Transcript: ENSMUST00000099576
AA Change: E389G
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: E389G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect unknown
Transcript: ENSMUST00000102547
AA Change: E389G
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: E389G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110954
Predicted Effect unknown
Transcript: ENSMUST00000161731
AA Change: E389G
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: E389G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,066,962 E373G probably damaging Het
Dsg1b G A 18: 20,399,587 V563I probably damaging Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam171b T A 2: 83,878,261 I369K probably benign Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Grip1 G A 10: 119,985,630 probably null Het
Heatr1 C A 13: 12,413,348 L789I possibly damaging Het
Hsd17b1 T C 11: 101,078,703 S59P probably damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Larp4 T A 15: 99,990,357 W92R probably damaging Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mfsd4b2 A G 10: 39,921,531 I276T possibly damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Myo18b T A 5: 112,757,596 E2045D probably damaging Het
Mypn T C 10: 63,147,982 T496A possibly damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Olfr142 T C 2: 90,252,625 Y121C probably damaging Het
Olfr273 A T 4: 52,855,636 N292K probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr710 A T 7: 106,944,312 S230T probably benign Het
Olfr952 A T 9: 39,426,605 S155R possibly damaging Het
Pik3c2g A T 6: 139,622,387 Y167F probably damaging Het
Pik3cg A C 12: 32,194,709 C915W probably damaging Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Rapgef1 C T 2: 29,719,689 H675Y possibly damaging Het
Rpn2 T A 2: 157,299,557 V263D probably damaging Het
Rps13 A G 7: 116,333,925 L16P probably damaging Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Smarcc2 G A 10: 128,482,943 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Spag9 G A 11: 94,099,026 probably null Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syt17 A G 7: 118,433,957 L215P probably damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tph2 T C 10: 115,080,005 D421G probably benign Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Vdac3 T C 8: 22,580,509 N128D probably benign Het
Vegfb G A 19: 6,987,399 probably benign Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGATTCAGGAACCATCTGC -3'
(R):5'- ATTTATGGCCACTCTGCGGTAG -3'

Sequencing Primer
(F):5'- TCTGCCCCAGTAAAACGAATAGTTAG -3'
(R):5'- GGCCCTTGTGTTGAGAGAGAAG -3'
Posted On2015-03-25