Mutagenetix > Incidental Mutation

Incidental Mutation 'R3777:Rps13'

271838

Institutional Source

Beutler Lab

Gene Symbol

Rps13

Ensembl Gene

ENSMUSG00000090862

Gene Name

ribosomal protein S13

Synonyms

2700063M04Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R3777 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115930742-115933425 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115933160 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 16 (L16P)

Ref Sequence

ENSEMBL: ENSMUSP00000146272 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000170953] [ENSMUST00000205490] [ENSMUST00000205906]

AlphaFold

P62301

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082807

Predicted Effect

probably benign
Transcript: ENSMUST00000170430

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000170953
AA Change: L16P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000126294
Gene: ENSMUSG00000090862
AA Change: L16P

Domain	Start	End	E-Value	Type
Ribosomal_S13_N	1	60	1.18e-36	SMART
Ribosomal_S15	70	149	8.24e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205265

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205490
AA Change: L16P

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205548

Predicted Effect

probably damaging
Transcript: ENSMUST00000205906
AA Change: L16P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206805

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206712

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206963

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206492

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206748

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205941

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206930

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S15P family of ribosomal proteins. It is located in the cytoplasm. The protein has been shown to bind to the 5.8S rRNA in rat. The gene product of the E. coli ortholog (ribosomal protein S15) functions at early steps in ribosome assembly. This gene is co-transcribed with two U14 small nucleolar RNA genes, which are located in its third and fifth introns. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Dsg1b	G	A	18: 20,532,644 (GRCm39)	V563I	probably damaging	Het
Elovl4	ACT	A	9: 83,667,201 (GRCm39)		probably null	Het
Erp27	A	T	6: 136,896,901 (GRCm39)	N100K	possibly damaging	Het
Fam171b	T	A	2: 83,708,605 (GRCm39)	I369K	probably benign	Het
Fmn1	A	G	2: 113,195,467 (GRCm39)	E389G	unknown	Het
Gm14569	T	A	X: 35,696,085 (GRCm39)	M875L	probably benign	Het
Gm5819	A	G	18: 8,694,429 (GRCm39)	E118G	probably damaging	Het
Grip1	G	A	10: 119,821,535 (GRCm39)		probably null	Het
Heatr1	C	A	13: 12,428,229 (GRCm39)	L789I	possibly damaging	Het
Hsd17b1	T	C	11: 100,969,529 (GRCm39)	S59P	probably damaging	Het
Ighv1-72	A	T	12: 115,721,636 (GRCm39)	S107T	probably damaging	Het
Inpp4b	T	A	8: 82,768,621 (GRCm39)	V710D	possibly damaging	Het
Kcnd3	C	T	3: 105,566,082 (GRCm39)	A421V	probably damaging	Het
Larp4	T	A	15: 99,888,238 (GRCm39)	W92R	probably damaging	Het
Man2b2	T	C	5: 36,972,871 (GRCm39)	N548D	probably benign	Het
Mfsd4b2	A	G	10: 39,797,527 (GRCm39)	I276T	possibly damaging	Het
Mki67	A	C	7: 135,297,859 (GRCm39)	S2392A	probably benign	Het
Myl12a	G	T	17: 71,301,631 (GRCm39)	H165Q	possibly damaging	Het
Myo18b	T	A	5: 112,905,462 (GRCm39)	E2045D	probably damaging	Het
Mypn	T	C	10: 62,983,761 (GRCm39)	T496A	possibly damaging	Het
Ncoa7	A	G	10: 30,565,752 (GRCm39)	Y632H	probably damaging	Het
Or13c3	A	T	4: 52,855,636 (GRCm39)	N292K	probably damaging	Het
Or2d4	A	T	7: 106,543,519 (GRCm39)	S230T	probably benign	Het
Or4b13	T	C	2: 90,082,969 (GRCm39)	Y121C	probably damaging	Het
Or5p52	C	A	7: 107,501,954 (GRCm39)	A10E	probably benign	Het
Or8g33	A	T	9: 39,337,901 (GRCm39)	S155R	possibly damaging	Het
Pik3c2g	A	T	6: 139,599,385 (GRCm39)	Y167F	probably damaging	Het
Pik3cg	A	C	12: 32,244,708 (GRCm39)	C915W	probably damaging	Het
Ppfibp2	A	G	7: 107,328,396 (GRCm39)	T476A	probably benign	Het
Rapgef1	C	T	2: 29,609,701 (GRCm39)	H675Y	possibly damaging	Het
Rpn2	T	A	2: 157,141,477 (GRCm39)	V263D	probably damaging	Het
Rsph14	C	G	10: 74,793,419 (GRCm39)	Q360H	possibly damaging	Het
Rsph14	T	G	10: 74,793,420 (GRCm39)	Q360P	possibly damaging	Het
Semp2l2b	T	C	10: 21,942,861 (GRCm39)	E373G	probably damaging	Het
Smarcc2	G	A	10: 128,318,812 (GRCm39)		probably null	Het
Sp8	G	T	12: 118,812,750 (GRCm39)	V202L	possibly damaging	Het
Spag9	G	A	11: 93,989,852 (GRCm39)		probably null	Het
Svil	A	G	18: 5,090,855 (GRCm39)	N915S	probably damaging	Het
Syt17	A	G	7: 118,033,180 (GRCm39)	L215P	probably damaging	Het
Tle6	G	T	10: 81,431,987 (GRCm39)	P86T	probably benign	Het
Tph2	T	C	10: 114,915,910 (GRCm39)	D421G	probably benign	Het
Trpm2	A	C	10: 77,771,824 (GRCm39)	L605R	probably benign	Het
Vat1l	T	C	8: 114,963,540 (GRCm39)		probably null	Het
Vdac3	T	C	8: 23,070,525 (GRCm39)	N128D	probably benign	Het
Vegfb	G	A	19: 6,964,767 (GRCm39)		probably benign	Het
Zfp808	T	A	13: 62,319,717 (GRCm39)	N315K	probably damaging	Het

Other mutations in Rps13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01994:Rps13	APN	7	115,932,925 (GRCm39)	splice site	probably benign
R5286:Rps13	UTSW	7	115,933,155 (GRCm39)	missense	probably damaging	1.00
R6001:Rps13	UTSW	7	115,930,808 (GRCm39)	missense	probably benign	0.01
Z1177:Rps13	UTSW	7	115,933,320 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGAGTCAGGCCTTTCTTG -3'
(R):5'- CATCATGGGTCGCATGCAC -3'

Sequencing Primer
(F):5'- TGGCCAATTTGTAAATCTGTTCC -3'
(R):5'- GGTCGCATGCACGCTCC -3'

Posted On

2015-03-25