Incidental Mutation 'R3778:Pik3c2g'
ID271896
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission 040750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3778 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139622387 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 167 (Y167F)
Ref Sequence ENSEMBL: ENSMUSP00000140368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032353] [ENSMUST00000185968] [ENSMUST00000187618] [ENSMUST00000188066] [ENSMUST00000190962]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032353
AA Change: Y167F

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032353
Gene: ENSMUSG00000030228
AA Change: Y167F

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185968
AA Change: Y167F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140368
Gene: ENSMUSG00000030228
AA Change: Y167F

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 371 2e-42 SMART
Blast:PI3K_rbd 272 371 2e-64 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186585
Predicted Effect possibly damaging
Transcript: ENSMUST00000187618
AA Change: Y167F

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141025
Gene: ENSMUSG00000030228
AA Change: Y167F

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000188066
AA Change: Y167F

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000190962
AA Change: Y167F

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141141
Gene: ENSMUSG00000030228
AA Change: Y167F

DomainStartEndE-ValueType
SCOP:d1e8xa3 223 344 4e-33 SMART
Blast:PI3K_rbd 272 345 7e-44 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A T 15: 64,746,997 L769H probably damaging Het
Aldh1a7 A T 19: 20,719,311 M106K possibly damaging Het
Ankfn1 G T 11: 89,441,394 P442Q probably damaging Het
Aox1 A C 1: 58,053,703 D158A possibly damaging Het
Apc A G 18: 34,313,081 N976S probably damaging Het
Cfap54 C T 10: 92,904,344 probably benign Het
Cldn1 C T 16: 26,371,466 C54Y probably damaging Het
Col22a1 A T 15: 71,973,692 I407N probably damaging Het
Cyp2e1 T C 7: 140,763,909 V20A possibly damaging Het
Erp27 A T 6: 136,919,903 N100K possibly damaging Het
Fam160a2 T A 7: 105,388,228 T383S probably damaging Het
Fbn1 C T 2: 125,317,086 C2253Y probably damaging Het
Flnb G A 14: 7,915,353 V1495I probably benign Het
Fscn3 A C 6: 28,430,032 K67T possibly damaging Het
Gls A G 1: 52,168,912 V571A probably benign Het
Gm14569 T A X: 36,432,432 M875L probably benign Het
Gm4871 A G 5: 145,030,083 S197P probably damaging Het
Gm7104 A T 12: 88,285,671 noncoding transcript Het
Gp9 A T 6: 87,779,005 M1L probably benign Het
Greb1l T A 18: 10,469,444 L153H possibly damaging Het
H1foo T C 6: 115,949,747 probably null Het
Hadha A T 5: 30,120,129 C688S probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmcn1 A T 1: 150,802,824 D515E possibly damaging Het
Hsfy2 A T 1: 56,636,688 V230E possibly damaging Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Inpp4b T A 8: 82,041,992 V710D possibly damaging Het
Itpr3 A G 17: 27,095,472 D632G possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Lrig2 A G 3: 104,457,961 I625T probably benign Het
Lrp2 A T 2: 69,509,204 M1121K probably benign Het
Man2b2 T C 5: 36,815,527 N548D probably benign Het
Mei1 T C 15: 82,082,008 L277P probably damaging Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Mycbp2 T A 14: 103,197,285 I2241F probably damaging Het
Nalcn G A 14: 123,464,716 T461M probably damaging Het
Ncoa6 A G 2: 155,421,195 S440P probably damaging Het
Ncoa7 A G 10: 30,689,756 Y632H probably damaging Het
Notch2 T C 3: 98,146,623 S2201P probably damaging Het
Olfr472 C A 7: 107,902,747 A10E probably benign Het
Olfr95 T C 17: 37,211,758 T32A probably benign Het
Pard6g A T 18: 80,079,823 probably null Het
Pask T A 1: 93,327,467 I294F probably damaging Het
Pax9 A G 12: 56,696,748 Y60C probably damaging Het
Pcdh15 G A 10: 73,947,151 probably null Het
Ppfibp2 A G 7: 107,729,189 T476A probably benign Het
Ppm1e T C 11: 87,248,928 probably null Het
Pqlc2 T C 4: 139,298,982 probably null Het
Rsph14 C G 10: 74,957,587 Q360H possibly damaging Het
Rsph14 T G 10: 74,957,588 Q360P possibly damaging Het
Sec24c A G 14: 20,683,307 Q234R possibly damaging Het
Shcbp1 A T 8: 4,736,295 N602K probably benign Het
Sirt5 A G 13: 43,383,107 probably null Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Tle6 G T 10: 81,596,153 P86T probably benign Het
Tmem235 A T 11: 117,862,300 H83L probably benign Het
Trappc10 A G 10: 78,200,802 V861A possibly damaging Het
Trpm2 A C 10: 77,935,990 L605R probably benign Het
Vat1l T C 8: 114,236,800 probably null Het
Wnt6 A C 1: 74,782,782 D174A possibly damaging Het
Wwox T C 8: 114,874,607 C355R probably benign Het
Zfp229 A T 17: 21,745,202 T138S probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 unclassified probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense probably damaging 1.00
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCTTCGGTTTGGAAAAC -3'
(R):5'- TGCACTGCACATACCTCTG -3'

Sequencing Primer
(F):5'- GCTTCGGTTTGGAAAACTATCAGCC -3'
(R):5'- TGTGCTTTCCACTGACACG -3'
Posted On2015-03-25