Incidental Mutation 'R3779:Pkn2'
ID271950
Institutional Source Beutler Lab
Gene Symbol Pkn2
Ensembl Gene ENSMUSG00000004591
Gene Nameprotein kinase N2
SynonymsPRK2, Stk7, Prkcl2, 6030436C20Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3779 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location142790902-142882004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142793980 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 928 (V928A)
Ref Sequence ENSEMBL: ENSMUSP00000039566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043812] [ENSMUST00000173830] [ENSMUST00000173913] [ENSMUST00000174422]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043812
AA Change: V928A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039566
Gene: ENSMUSG00000004591
AA Change: V928A

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 462 2.72e-8 SMART
low complexity region 535 546 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
S_TKc 656 915 7.94e-100 SMART
S_TK_X 916 980 6.77e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157170
Predicted Effect probably benign
Transcript: ENSMUST00000173830
AA Change: V880A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000133691
Gene: ENSMUSG00000004591
AA Change: V880A

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
low complexity region 364 380 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 522 530 N/A INTRINSIC
S_TKc 608 867 7.94e-100 SMART
S_TK_X 868 932 6.77e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173913
Predicted Effect probably benign
Transcript: ENSMUST00000174422
AA Change: V912A

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134559
Gene: ENSMUSG00000004591
AA Change: V912A

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 446 2.92e-8 SMART
low complexity region 519 530 N/A INTRINSIC
low complexity region 554 562 N/A INTRINSIC
S_TKc 640 899 7.94e-100 SMART
S_TK_X 900 964 6.77e-16 SMART
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality during organogenesis with impaired mesenchymal cell proliferation and neural crest cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,385 C73R probably damaging Het
Acot10 A G 15: 20,665,542 V371A probably damaging Het
Ambn C A 5: 88,465,342 probably benign Het
Ankrd34a T C 3: 96,598,931 F484L possibly damaging Het
Bcl11a A G 11: 24,164,568 K637R probably damaging Het
Cenpe T C 3: 135,256,576 S1968P possibly damaging Het
Cfap61 T C 2: 145,950,794 I52T probably damaging Het
Cit A T 5: 115,859,341 M128L probably benign Het
Cnga1 G T 5: 72,604,783 L463I probably damaging Het
Dnah11 C T 12: 118,130,713 probably benign Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Ep400 A G 5: 110,691,649 I1853T unknown Het
Flg2 C T 3: 93,202,423 S586L unknown Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm21886 G T 18: 80,089,434 Q170K possibly damaging Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Gm9376 T C 14: 118,267,315 V53A probably benign Het
H2-T3 T C 17: 36,189,682 T90A probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmgcs2 C T 3: 98,299,112 probably benign Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Jak1 G A 4: 101,156,490 H1014Y probably benign Het
Klrb1c T C 6: 128,780,343 D253G probably damaging Het
Lpin1 G A 12: 16,564,568 T404M probably damaging Het
Map3k9 A T 12: 81,743,791 probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Olfr768 A G 10: 129,093,296 F226S possibly damaging Het
Pdgfrb T A 18: 61,072,666 S575T probably damaging Het
Phldb2 T C 16: 45,748,755 Y1247C probably damaging Het
Pinlyp T A 7: 24,541,835 T181S probably benign Het
Skint5 C T 4: 113,779,040 probably benign Het
Skiv2l2 A T 13: 112,903,392 probably benign Het
Slc24a1 A G 9: 64,948,297 Y443H unknown Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syncrip A C 9: 88,476,939 D172E probably damaging Het
Tex26 T C 5: 149,445,851 I48T probably damaging Het
Trpm6 A C 19: 18,876,039 I1808L possibly damaging Het
Uba2 T C 7: 34,154,646 probably null Het
Vwa8 T A 14: 79,102,322 probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Wrn T A 8: 33,241,020 R1095W probably damaging Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Pkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Pkn2 APN 3 142799019 missense probably damaging 1.00
IGL00852:Pkn2 APN 3 142809816 unclassified probably benign
IGL00917:Pkn2 APN 3 142853625 missense probably damaging 1.00
IGL01147:Pkn2 APN 3 142829009 missense probably benign 0.06
IGL01556:Pkn2 APN 3 142829317 missense possibly damaging 0.88
IGL01574:Pkn2 APN 3 142839231 missense possibly damaging 0.48
IGL02058:Pkn2 APN 3 142803663 missense probably damaging 0.97
IGL02136:Pkn2 APN 3 142853590 missense probably damaging 1.00
IGL02310:Pkn2 APN 3 142811580 missense probably damaging 1.00
IGL02540:Pkn2 APN 3 142809704 missense probably benign 0.01
IGL02607:Pkn2 APN 3 142794101 critical splice donor site probably null
IGL03256:Pkn2 APN 3 142803550 splice site probably null
voodoo UTSW 3 142853538 missense possibly damaging 0.78
R0001:Pkn2 UTSW 3 142828988 missense probably benign 0.00
R0048:Pkn2 UTSW 3 142810827 missense probably damaging 1.00
R0081:Pkn2 UTSW 3 142853582 missense probably damaging 1.00
R0514:Pkn2 UTSW 3 142810458 missense possibly damaging 0.76
R0670:Pkn2 UTSW 3 142839343 missense probably damaging 0.99
R0709:Pkn2 UTSW 3 142830520 missense probably damaging 0.98
R1025:Pkn2 UTSW 3 142821565 critical splice donor site probably null
R1190:Pkn2 UTSW 3 142811525 critical splice donor site probably null
R1602:Pkn2 UTSW 3 142853538 missense possibly damaging 0.78
R1729:Pkn2 UTSW 3 142810701 missense probably benign 0.00
R1756:Pkn2 UTSW 3 142810727 missense possibly damaging 0.94
R1764:Pkn2 UTSW 3 142793854 missense probably damaging 1.00
R1797:Pkn2 UTSW 3 142809528 missense probably damaging 1.00
R1833:Pkn2 UTSW 3 142821647 missense probably damaging 1.00
R2035:Pkn2 UTSW 3 142820587 missense probably damaging 0.99
R2058:Pkn2 UTSW 3 142853471 missense possibly damaging 0.93
R3940:Pkn2 UTSW 3 142793911 missense probably damaging 1.00
R3967:Pkn2 UTSW 3 142809677 missense probably damaging 0.98
R4008:Pkn2 UTSW 3 142810458 missense possibly damaging 0.76
R4160:Pkn2 UTSW 3 142803564 missense probably benign 0.42
R4222:Pkn2 UTSW 3 142793866 nonsense probably null
R4243:Pkn2 UTSW 3 142820578 missense possibly damaging 0.64
R4380:Pkn2 UTSW 3 142830456 unclassified probably benign
R4826:Pkn2 UTSW 3 142809509 missense probably damaging 1.00
R4869:Pkn2 UTSW 3 142803618 missense probably damaging 1.00
R5096:Pkn2 UTSW 3 142839331 missense probably damaging 0.99
R5175:Pkn2 UTSW 3 142798923 missense probably damaging 1.00
R5301:Pkn2 UTSW 3 142839206 critical splice donor site probably null
R5839:Pkn2 UTSW 3 142821529 missense probably benign 0.02
R6155:Pkn2 UTSW 3 142853693 missense probably benign 0.00
R6198:Pkn2 UTSW 3 142810404 missense probably benign 0.00
R6255:Pkn2 UTSW 3 142811599 missense probably damaging 1.00
R6293:Pkn2 UTSW 3 142809704 missense probably benign 0.15
R6494:Pkn2 UTSW 3 142803668 missense possibly damaging 0.94
R6659:Pkn2 UTSW 3 142803587 missense probably damaging 1.00
R6809:Pkn2 UTSW 3 142799004 missense probably damaging 1.00
R7267:Pkn2 UTSW 3 142812015 missense possibly damaging 0.90
R7367:Pkn2 UTSW 3 142810727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTCTGCTTGGTCTCAGG -3'
(R):5'- AGCTGCTAAGGAGAAATCCTG -3'

Sequencing Primer
(F):5'- GGTCTCAGGGTCTAGAAACTTAACAC -3'
(R):5'- AGAAATCCTGAGCGGCGC -3'
Posted On2015-03-25