Incidental Mutation 'R3780:Sacm1l'
ID272010
Institutional Source Beutler Lab
Gene Symbol Sacm1l
Ensembl Gene ENSMUSG00000025240
Gene NameSAC1 suppressor of actin mutations 1-like (yeast)
SynonymsSAC1, Sac1p
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R3780 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123529759-123592600 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123552790 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 152 (E152D)
Ref Sequence ENSEMBL: ENSMUSP00000026270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026270] [ENSMUST00000217045]
Predicted Effect probably benign
Transcript: ENSMUST00000026270
AA Change: E152D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000026270
Gene: ENSMUSG00000025240
AA Change: E152D

DomainStartEndE-ValueType
Pfam:Syja_N 58 346 4.7e-88 PFAM
low complexity region 400 415 N/A INTRINSIC
Blast:IPPc 416 500 3e-12 BLAST
transmembrane domain 521 543 N/A INTRINSIC
transmembrane domain 550 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217045
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is localized to the endoplasmic reticulum and golgi, and functions as a phosphoinositide lipid phosphatase. Studies in mammals suggest that this gene is involved in the organization of golgi membranes and the mitotic spindles. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,560,838 noncoding transcript Het
Adam21 C T 12: 81,559,273 V572I probably damaging Het
Arhgap32 T A 9: 32,152,019 probably null Het
Carmil1 A T 13: 24,137,169 I281N probably damaging Het
Cdh12 T A 15: 21,585,977 probably null Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cntrob A G 11: 69,302,882 L814P probably damaging Het
Csmd1 T C 8: 16,201,986 N952S probably damaging Het
Cspg4 A G 9: 56,888,233 Y1084C probably damaging Het
Dlg5 A G 14: 24,190,310 probably benign Het
Glis2 T C 16: 4,613,896 probably benign Het
Hif3a T C 7: 17,054,713 E111G probably damaging Het
Kctd4 A G 14: 75,962,811 D74G probably benign Het
Kif21b A T 1: 136,156,226 K737M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama2 A T 10: 27,459,339 N113K probably damaging Het
Ltv1 A G 10: 13,179,200 S409P probably benign Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Myh6 A G 14: 54,963,958 F95L probably benign Het
Ndufa4l2 A G 10: 127,515,420 I27V probably benign Het
Npepl1 T G 2: 174,120,654 L371R probably damaging Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Ocrl G A X: 47,938,303 V416I probably benign Het
Olfr123 T G 17: 37,796,004 C187G probably damaging Het
Padi2 C T 4: 140,917,737 T94I probably benign Het
Pcca G A 14: 122,684,885 E353K probably damaging Het
Pcdhgb2 T A 18: 37,691,757 N600K probably damaging Het
Pex5l A G 3: 32,950,844 L593P probably damaging Het
Rbp2 G A 9: 98,498,826 D62N probably benign Het
Rock1 G T 18: 10,067,575 N1319K probably benign Het
Ror1 A C 4: 100,412,117 D384A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Seh1l T C 18: 67,775,017 V3A probably benign Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Serpini1 T G 3: 75,614,635 N144K probably damaging Het
Slc22a23 G A 13: 34,344,340 T153I probably benign Het
Slfn8 A G 11: 83,017,454 S88P probably benign Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn2r115 G A 17: 23,345,172 C106Y probably damaging Het
Washc3 C T 10: 88,219,260 T112M probably benign Het
Zfp280d C T 9: 72,322,524 T346M probably damaging Het
Other mutations in Sacm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Sacm1l APN 9 123570549 missense possibly damaging 0.88
IGL02598:Sacm1l APN 9 123578996 missense probably benign 0.03
IGL02796:Sacm1l UTSW 9 123548924 missense possibly damaging 0.66
R0138:Sacm1l UTSW 9 123548917 missense probably benign 0.15
R0628:Sacm1l UTSW 9 123548995 splice site probably benign
R0847:Sacm1l UTSW 9 123548862 missense probably damaging 1.00
R1102:Sacm1l UTSW 9 123582298 missense probably damaging 0.98
R1159:Sacm1l UTSW 9 123566411 missense probably benign 0.06
R2898:Sacm1l UTSW 9 123560601 critical splice donor site probably null
R3001:Sacm1l UTSW 9 123585084 splice site probably benign
R3852:Sacm1l UTSW 9 123587576 missense probably damaging 1.00
R4731:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4732:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4733:Sacm1l UTSW 9 123590830 missense probably benign 0.03
R4894:Sacm1l UTSW 9 123582344 missense probably benign 0.17
R5021:Sacm1l UTSW 9 123582328 missense probably damaging 1.00
R5033:Sacm1l UTSW 9 123586399 missense probably damaging 1.00
R5075:Sacm1l UTSW 9 123582262 missense probably benign 0.00
R5135:Sacm1l UTSW 9 123577025 missense probably benign 0.00
R5284:Sacm1l UTSW 9 123586420 missense probably damaging 0.99
R5514:Sacm1l UTSW 9 123586354 nonsense probably null
R5629:Sacm1l UTSW 9 123566399 missense probably benign
R6137:Sacm1l UTSW 9 123569005 missense probably damaging 1.00
R6266:Sacm1l UTSW 9 123542420 missense probably damaging 1.00
R7079:Sacm1l UTSW 9 123569997 missense probably damaging 1.00
R7147:Sacm1l UTSW 9 123568951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTACACCTCTTCAGAATGCTTG -3'
(R):5'- TGGTGAGGCCAGTGATAAGAATTTG -3'

Sequencing Primer
(F):5'- TGACCTGGAACTCACTGTGTAGAC -3'
(R):5'- TATGGCTCAATGGGCAAGTGC -3'
Posted On2015-03-25