Incidental Mutation 'R3780:Slc22a23'
ID272021
Institutional Source Beutler Lab
Gene Symbol Slc22a23
Ensembl Gene ENSMUSG00000038267
Gene Namesolute carrier family 22, member 23
Synonyms3110004L20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R3780 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location34179158-34345182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34344340 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 153 (T153I)
Ref Sequence ENSEMBL: ENSMUSP00000042742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040336]
Predicted Effect probably benign
Transcript: ENSMUST00000040336
AA Change: T153I

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: T153I

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
Pfam:Sugar_tr 187 633 5e-26 PFAM
Pfam:MFS_1 224 518 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143353
Predicted Effect unknown
Transcript: ENSMUST00000145038
AA Change: T85I
SMART Domains Protein: ENSMUSP00000122376
Gene: ENSMUSG00000038267
AA Change: T85I

DomainStartEndE-ValueType
low complexity region 86 97 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148390
AA Change: T37I
SMART Domains Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: T37I

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
Pfam:Sugar_tr 71 510 1.4e-27 PFAM
Pfam:MFS_1 109 402 1.5e-12 PFAM
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,560,838 noncoding transcript Het
Adam21 C T 12: 81,559,273 V572I probably damaging Het
Arhgap32 T A 9: 32,152,019 probably null Het
Carmil1 A T 13: 24,137,169 I281N probably damaging Het
Cdh12 T A 15: 21,585,977 probably null Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cntrob A G 11: 69,302,882 L814P probably damaging Het
Csmd1 T C 8: 16,201,986 N952S probably damaging Het
Cspg4 A G 9: 56,888,233 Y1084C probably damaging Het
Dlg5 A G 14: 24,190,310 probably benign Het
Glis2 T C 16: 4,613,896 probably benign Het
Hif3a T C 7: 17,054,713 E111G probably damaging Het
Kctd4 A G 14: 75,962,811 D74G probably benign Het
Kif21b A T 1: 136,156,226 K737M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama2 A T 10: 27,459,339 N113K probably damaging Het
Ltv1 A G 10: 13,179,200 S409P probably benign Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Myh6 A G 14: 54,963,958 F95L probably benign Het
Ndufa4l2 A G 10: 127,515,420 I27V probably benign Het
Npepl1 T G 2: 174,120,654 L371R probably damaging Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Ocrl G A X: 47,938,303 V416I probably benign Het
Olfr123 T G 17: 37,796,004 C187G probably damaging Het
Padi2 C T 4: 140,917,737 T94I probably benign Het
Pcca G A 14: 122,684,885 E353K probably damaging Het
Pcdhgb2 T A 18: 37,691,757 N600K probably damaging Het
Pex5l A G 3: 32,950,844 L593P probably damaging Het
Rbp2 G A 9: 98,498,826 D62N probably benign Het
Rock1 G T 18: 10,067,575 N1319K probably benign Het
Ror1 A C 4: 100,412,117 D384A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sacm1l A T 9: 123,552,790 E152D probably benign Het
Seh1l T C 18: 67,775,017 V3A probably benign Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Serpini1 T G 3: 75,614,635 N144K probably damaging Het
Slfn8 A G 11: 83,017,454 S88P probably benign Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Vmn2r115 G A 17: 23,345,172 C106Y probably damaging Het
Washc3 C T 10: 88,219,260 T112M probably benign Het
Zfp280d C T 9: 72,322,524 T346M probably damaging Het
Other mutations in Slc22a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slc22a23 APN 13 34305245 missense probably damaging 1.00
IGL01762:Slc22a23 APN 13 34204001 missense possibly damaging 0.71
IGL02496:Slc22a23 APN 13 34344485 missense possibly damaging 0.93
IGL02516:Slc22a23 APN 13 34203955 missense probably benign 0.02
IGL02831:Slc22a23 APN 13 34299069 missense possibly damaging 0.81
foreshadowed UTSW 13 34195479 missense probably damaging 0.98
foretold UTSW 13 34305180 missense probably benign 0.08
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0413:Slc22a23 UTSW 13 34183132 missense probably damaging 1.00
R0557:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0558:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0636:Slc22a23 UTSW 13 34299093 missense probably benign 0.01
R0676:Slc22a23 UTSW 13 34195479 missense probably damaging 0.98
R0739:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0990:Slc22a23 UTSW 13 34195467 missense probably damaging 1.00
R1515:Slc22a23 UTSW 13 34203964 missense probably benign 0.33
R2128:Slc22a23 UTSW 13 34203970 missense possibly damaging 0.76
R2147:Slc22a23 UTSW 13 34183007 missense probably benign 0.00
R3113:Slc22a23 UTSW 13 34183075 missense probably damaging 0.98
R3945:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R3946:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R4056:Slc22a23 UTSW 13 34299004 nonsense probably null
R4095:Slc22a23 UTSW 13 34305206 missense probably damaging 1.00
R4854:Slc22a23 UTSW 13 34203941 missense probably benign
R5594:Slc22a23 UTSW 13 34305257 missense probably damaging 0.99
R5611:Slc22a23 UTSW 13 34305239 missense probably benign 0.00
R6167:Slc22a23 UTSW 13 34344559 missense probably damaging 0.97
R6927:Slc22a23 UTSW 13 34344379 missense probably benign 0.07
R6933:Slc22a23 UTSW 13 34305180 missense probably benign 0.08
R6960:Slc22a23 UTSW 13 34344157 critical splice donor site probably null
R7291:Slc22a23 UTSW 13 34197839 missense probably damaging 0.99
R7313:Slc22a23 UTSW 13 34183178 missense probably damaging 1.00
X0064:Slc22a23 UTSW 13 34344466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTGGATGAGACCAGTGC -3'
(R):5'- CTGTTGCTGGACTACGATGG -3'

Sequencing Primer
(F):5'- ATGAGACCAGTGCGGATGCC -3'
(R):5'- TGGACTACGATGGCTCCGTG -3'
Posted On2015-03-25