Incidental Mutation 'R3780:Vmn2r115'
ID272030
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Namevomeronasal 2, receptor 115
SynonymsEG638102
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R3780 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23343977-23360128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23345172 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 106 (C106Y)
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
Predicted Effect probably damaging
Transcript: ENSMUST00000168175
AA Change: C106Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076
AA Change: C106Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Meta Mutation Damage Score 0.0368 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,560,838 noncoding transcript Het
Adam21 C T 12: 81,559,273 V572I probably damaging Het
Arhgap32 T A 9: 32,152,019 probably null Het
Carmil1 A T 13: 24,137,169 I281N probably damaging Het
Cdh12 T A 15: 21,585,977 probably null Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cntrob A G 11: 69,302,882 L814P probably damaging Het
Csmd1 T C 8: 16,201,986 N952S probably damaging Het
Cspg4 A G 9: 56,888,233 Y1084C probably damaging Het
Dlg5 A G 14: 24,190,310 probably benign Het
Glis2 T C 16: 4,613,896 probably benign Het
Hif3a T C 7: 17,054,713 E111G probably damaging Het
Kctd4 A G 14: 75,962,811 D74G probably benign Het
Kif21b A T 1: 136,156,226 K737M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama2 A T 10: 27,459,339 N113K probably damaging Het
Ltv1 A G 10: 13,179,200 S409P probably benign Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Myh6 A G 14: 54,963,958 F95L probably benign Het
Ndufa4l2 A G 10: 127,515,420 I27V probably benign Het
Npepl1 T G 2: 174,120,654 L371R probably damaging Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Ocrl G A X: 47,938,303 V416I probably benign Het
Olfr123 T G 17: 37,796,004 C187G probably damaging Het
Padi2 C T 4: 140,917,737 T94I probably benign Het
Pcca G A 14: 122,684,885 E353K probably damaging Het
Pcdhgb2 T A 18: 37,691,757 N600K probably damaging Het
Pex5l A G 3: 32,950,844 L593P probably damaging Het
Rbp2 G A 9: 98,498,826 D62N probably benign Het
Rock1 G T 18: 10,067,575 N1319K probably benign Het
Ror1 A C 4: 100,412,117 D384A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sacm1l A T 9: 123,552,790 E152D probably benign Het
Seh1l T C 18: 67,775,017 V3A probably benign Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Serpini1 T G 3: 75,614,635 N144K probably damaging Het
Slc22a23 G A 13: 34,344,340 T153I probably benign Het
Slfn8 A G 11: 83,017,454 S88P probably benign Het
Stpg3 T A 2: 25,213,863 M154L probably benign Het
Washc3 C T 10: 88,219,260 T112M probably benign Het
Zfp280d C T 9: 72,322,524 T346M probably damaging Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23346206 missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23346176 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23359349 missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23346339 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346278 missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23346161 missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23359397 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346371 nonsense probably null
IGL00990:Vmn2r115 APN 17 23346372 missense probably benign 0.30
IGL00990:Vmn2r115 APN 17 23356960 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23346264 missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23359779 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23359824 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23348034 nonsense probably null
IGL01073:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23345139 missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23359283 missense probably damaging 0.97
R0023:Vmn2r115 UTSW 17 23346278 missense probably benign 0.14
R0197:Vmn2r115 UTSW 17 23359781 missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23345222 missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23360100 missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23346264 missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23359275 missense probably benign
R0865:Vmn2r115 UTSW 17 23346408 missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1145:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1146:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1207:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1266:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1318:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1367:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1420:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23345271 missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23346218 missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23359539 missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1678:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1716:Vmn2r115 UTSW 17 23347821 missense probably benign
R1846:Vmn2r115 UTSW 17 23359383 missense probably damaging 1.00
R1847:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1885:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1887:Vmn2r115 UTSW 17 23346033 missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23359414 missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23347953 missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23359323 missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23357024 missense possibly damaging 0.82
R3806:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R3982:Vmn2r115 UTSW 17 23359974 missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23360043 missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23345103 missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23345223 missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23345880 missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23346399 missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23359851 missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23360056 missense probably damaging 1.00
R5613:Vmn2r115 UTSW 17 23345333 missense probably benign
R5821:Vmn2r115 UTSW 17 23347963 missense probably damaging 0.99
R6120:Vmn2r115 UTSW 17 23346029 missense probably damaging 1.00
R6193:Vmn2r115 UTSW 17 23357009 missense probably benign 0.01
R6213:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6290:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6319:Vmn2r115 UTSW 17 23347903 missense possibly damaging 0.70
R6495:Vmn2r115 UTSW 17 23359598 missense probably benign 0.02
R6599:Vmn2r115 UTSW 17 23346032 missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23346072 missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23346015 missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23359811 missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23359602 missense probably benign 0.01
V5622:Vmn2r115 UTSW 17 23346227 missense probably damaging 1.00
V5622:Vmn2r115 UTSW 17 23359359 missense probably benign
X0023:Vmn2r115 UTSW 17 23359988 small deletion probably benign
X0033:Vmn2r115 UTSW 17 23359988 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ATGCAATCCAGTGTAGAATTGTCC -3'
(R):5'- GACAGAATTCCCACTCTGCCTC -3'

Sequencing Primer
(F):5'- TCCAGTGTAGAATTGTCCTTTTATTG -3'
(R):5'- CACACTTACCTGCTGAGATATGAAG -3'
Posted On2015-03-25