Mutagenetix > Incidental Mutation

Incidental Mutation 'R3781:Mcm7'

272043

Institutional Source

Beutler Lab

Gene Symbol

Mcm7

Ensembl Gene

ENSMUSG00000029730

Gene Name

minichromosome maintenance complex component 7

Synonyms

mCDC47, Mcmd7

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3781 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

138162845-138170675 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 138162998 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 385 (R385W)

Ref Sequence

ENSEMBL: ENSMUSP00000116131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019638] [ENSMUST00000110951] [ENSMUST00000148879] [ENSMUST00000132639] [ENSMUST00000139983] [ENSMUST00000153867] [ENSMUST00000155902] [ENSMUST00000148094] [ENSMUST00000147920]

AlphaFold

Q61881

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000505
AA Change: R715W

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730
AA Change: R715W

Domain	Start	End	E-Value	Type
Blast:MCM	48	132	1e-41	BLAST
MCM	145	642	N/A	SMART
AAA	373	526	2.9e-4	SMART
Blast:MCM	658	719	1e-32	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000019638

SMART Domains

Protein: ENSMUSP00000019638
Gene: ENSMUSG00000019494

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
JAB_MPN	37	170	9.73e-35	SMART
Pfam:MitMem_reg	191	304	1.1e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083593

Predicted Effect

probably benign
Transcript: ENSMUST00000110951

SMART Domains

Protein: ENSMUSP00000106576
Gene: ENSMUSG00000019494

Domain	Start	End	E-Value	Type
JAB_MPN	10	143	9.73e-35	SMART
Pfam:MitMem_reg	163	279	2.6e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125316

Predicted Effect

probably damaging
Transcript: ENSMUST00000148879
AA Change: R385W

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730
AA Change: R385W

Domain	Start	End	E-Value	Type
Blast:MCM	48	132	6e-44	BLAST
MCM	145	389	1.77e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127881

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139223

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142254

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154867

Predicted Effect

probably benign
Transcript: ENSMUST00000132639

SMART Domains

Protein: ENSMUSP00000121554
Gene: ENSMUSG00000019494

Domain	Start	End	E-Value	Type
Pfam:MitMem_reg	17	112	3.6e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139983

SMART Domains

Protein: ENSMUSP00000121446
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Pfam:MCM_N	1	58	5.3e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000153867

SMART Domains

Protein: ENSMUSP00000121566
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Pfam:MCM_N	1	58	9.5e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155902

SMART Domains

Protein: ENSMUSP00000120243
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Pfam:MCM_N	1	58	5.3e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148094

SMART Domains

Protein: ENSMUSP00000121344
Gene: ENSMUSG00000029730

Domain	Start	End	E-Value	Type
Blast:MCM	1	25	4e-7	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000147920

Meta Mutation Damage Score

0.0896

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 6 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. Cyclin D1-dependent kinase, CDK4, is found to associate with this protein, and may regulate the binding of this protein with the tumorsuppressor protein RB1/RB. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit increased micronulei-containing red blood cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bap1	T	C	14: 30,979,575 (GRCm39)	I526T	possibly damaging	Het
Calcr	T	C	6: 3,700,193 (GRCm39)	T263A	possibly damaging	Het
Cdh20	T	A	1: 109,976,734 (GRCm39)	V133E	probably benign	Het
Ddx5	T	C	11: 106,675,346 (GRCm39)	I330V	probably benign	Het
Dysf	G	A	6: 84,163,491 (GRCm39)		probably null	Het
Gnl2	T	C	4: 124,931,399 (GRCm39)	V110A	probably damaging	Het
H2-Q10	A	G	17: 35,781,915 (GRCm39)	Y179C	possibly damaging	Het
Hlx	G	T	1: 184,464,184 (GRCm39)	A52D	probably damaging	Het
Map3k20	A	G	2: 72,232,699 (GRCm39)		probably benign	Het
Mgat4c	A	G	10: 102,224,782 (GRCm39)	E332G	probably benign	Het
Nudt3	A	G	17: 27,799,782 (GRCm39)	S134P	possibly damaging	Het
Or1e26	C	A	11: 73,479,839 (GRCm39)	G242C	probably damaging	Het
Or1e26	A	T	11: 73,480,194 (GRCm39)	Y123*	probably null	Het
Or4c100	A	T	2: 88,356,709 (GRCm39)	T261S	probably benign	Het
Or4c107	G	T	2: 88,789,091 (GRCm39)	E94*	probably null	Het
Or51h7	T	C	7: 102,591,278 (GRCm39)	I169V	probably benign	Het
Pcnx1	A	G	12: 82,042,892 (GRCm39)	T2325A	probably benign	Het
Plekha6	A	G	1: 133,222,393 (GRCm39)	E993G	probably damaging	Het
Psmd4	T	A	3: 94,944,039 (GRCm39)	Y15F	probably benign	Het
Rad23b	C	T	4: 55,382,586 (GRCm39)	T263M	probably damaging	Het
Stpg3	T	A	2: 25,103,875 (GRCm39)	M154L	probably benign	Het
Vmn1r45	C	A	6: 89,910,799 (GRCm39)	R57L	probably benign	Het
Zfp658	G	A	7: 43,223,270 (GRCm39)	R515H	probably benign	Het

Other mutations in Mcm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01649:Mcm7	APN	5	138,167,698 (GRCm39)	missense	probably damaging	1.00
IGL01954:Mcm7	APN	5	138,165,507 (GRCm39)	missense	probably damaging	1.00
IGL02611:Mcm7	APN	5	138,165,701 (GRCm39)	missense	probably damaging	1.00
ANU23:Mcm7	UTSW	5	138,168,653 (GRCm39)	missense	probably benign	0.02
PIT1430001:Mcm7	UTSW	5	138,165,708 (GRCm39)	unclassified	probably benign
R0022:Mcm7	UTSW	5	138,162,981 (GRCm39)	makesense	probably null
R1306:Mcm7	UTSW	5	138,165,465 (GRCm39)	missense	probably damaging	1.00
R1865:Mcm7	UTSW	5	138,168,637 (GRCm39)	missense	possibly damaging	0.47
R2132:Mcm7	UTSW	5	138,167,364 (GRCm39)	missense	probably damaging	1.00
R3719:Mcm7	UTSW	5	138,164,976 (GRCm39)	nonsense	probably null
R3782:Mcm7	UTSW	5	138,162,998 (GRCm39)	missense	probably damaging	0.99
R4724:Mcm7	UTSW	5	138,167,387 (GRCm39)	missense	probably damaging	1.00
R4882:Mcm7	UTSW	5	138,164,173 (GRCm39)	splice site	probably null
R5012:Mcm7	UTSW	5	138,167,609 (GRCm39)	critical splice donor site	probably null
R5517:Mcm7	UTSW	5	138,163,133 (GRCm39)	missense	possibly damaging	0.92
R5718:Mcm7	UTSW	5	138,163,081 (GRCm39)	missense	possibly damaging	0.95
R7604:Mcm7	UTSW	5	138,167,986 (GRCm39)	missense	probably benign	0.01
R8806:Mcm7	UTSW	5	138,163,347 (GRCm39)	missense	possibly damaging	0.81
R9139:Mcm7	UTSW	5	138,167,397 (GRCm39)	missense	probably damaging	1.00
R9209:Mcm7	UTSW	5	138,166,593 (GRCm39)	critical splice donor site	probably null
R9421:Mcm7	UTSW	5	138,165,477 (GRCm39)	missense	possibly damaging	0.76
R9681:Mcm7	UTSW	5	138,164,220 (GRCm39)	nonsense	probably null
R9707:Mcm7	UTSW	5	138,170,000 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAAGGCCTTCTATCTCCCAG -3'
(R):5'- GCAGATGTGATATTTGCCACC -3'

Sequencing Primer
(F):5'- TTGACTAGCACATAGTAAGGGTC -3'
(R):5'- AGATGTGATATTTGCCACCATCCG -3'

Posted On

2015-03-25