Mutagenetix > Incidental Mutation

Incidental Mutation 'R3782:Taf11'

272101

Institutional Source

Beutler Lab

Gene Symbol

Taf11

Ensembl Gene

ENSMUSG00000024218

Gene Name

TATA-box binding protein associated factor 11

Synonyms

TAF2I, PRO214, 28kDa, TAFII28, 1110038O14Rik

MMRRC Submission

040751-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3782 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28120096-28128723 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to G at 28122167 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025057] [ENSMUST00000114848] [ENSMUST00000114849]

AlphaFold

Q99JX1

Predicted Effect

probably benign
Transcript: ENSMUST00000025057

SMART Domains

Protein: ENSMUSP00000025057
Gene: ENSMUSG00000024218

Domain	Start	End	E-Value	Type
low complexity region	45	60	N/A	INTRINSIC
low complexity region	82	105	N/A	INTRINSIC
Pfam:TAFII28	106	194	1.7e-38	PFAM
Pfam:CBFD_NFYB_HMF	127	191	8.2e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114848

SMART Domains

Protein: ENSMUSP00000110498
Gene: ENSMUSG00000024218

Domain	Start	End	E-Value	Type
low complexity region	45	60	N/A	INTRINSIC
low complexity region	82	105	N/A	INTRINSIC
Pfam:TAFII28	108	193	3.1e-40	PFAM
Pfam:CBFD_NFYB_HMF	127	191	6.8e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114849

SMART Domains

Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	1	104	2.6e-18	PFAM
low complexity region	234	247	N/A	INTRINSIC
low complexity region	297	306	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
low complexity region	1200	1216	N/A	INTRINSIC
low complexity region	1322	1333	N/A	INTRINSIC
low complexity region	1375	1386	N/A	INTRINSIC
coiled coil region	1394	1424	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155667

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a small subunit of TFIID that is present in all TFIID complexes and interacts with TBP. This subunit also interacts with another small subunit, TAF13, to form a heterodimer with a structure similar to the histone core structure. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aimp2	T	A	5: 143,843,517 (GRCm39)	K24N	possibly damaging	Het
Atf6	A	T	1: 170,622,336 (GRCm39)	Y428*	probably null	Het
BC034090	T	C	1: 155,102,024 (GRCm39)	E80G	probably damaging	Het
Calcr	T	C	6: 3,700,193 (GRCm39)	T263A	possibly damaging	Het
Cdh20	T	A	1: 109,976,734 (GRCm39)	V133E	probably benign	Het
Cpsf3	A	C	12: 21,350,067 (GRCm39)	E262A	possibly damaging	Het
Ddx5	T	C	11: 106,675,346 (GRCm39)	I330V	probably benign	Het
Dlg5	A	G	14: 24,240,378 (GRCm39)		probably benign	Het
Enam	A	T	5: 88,650,674 (GRCm39)	S653C	probably damaging	Het
Fndc3b	A	T	3: 27,514,135 (GRCm39)	V682D	possibly damaging	Het
Guf1	A	T	5: 69,724,495 (GRCm39)	M396L	probably benign	Het
H2-Q10	A	G	17: 35,781,915 (GRCm39)	Y179C	possibly damaging	Het
Hlx	G	T	1: 184,464,184 (GRCm39)	A52D	probably damaging	Het
Hpgd	G	A	8: 56,751,453 (GRCm39)	V94M	probably damaging	Het
Ktn1	G	A	14: 47,943,860 (GRCm39)		probably benign	Het
Lama5	T	G	2: 179,836,356 (GRCm39)	H1165P	possibly damaging	Het
Lrrfip1	A	G	1: 91,039,911 (GRCm39)	T205A	possibly damaging	Het
Mcm7	G	A	5: 138,162,998 (GRCm39)	R385W	probably damaging	Het
Mgat4c	A	G	10: 102,224,782 (GRCm39)	E332G	probably benign	Het
Mpp7	A	T	18: 7,351,085 (GRCm39)	H537Q	probably damaging	Het
Mx1	T	C	16: 97,253,195 (GRCm39)	D380G	possibly damaging	Het
Nckap5	T	A	1: 125,952,811 (GRCm39)	Q1183L	possibly damaging	Het
Nkx1-2	A	G	7: 132,199,161 (GRCm39)	V200A	probably damaging	Het
Nr3c2	T	A	8: 77,812,313 (GRCm39)		probably null	Het
Nsmce1	C	T	7: 125,085,549 (GRCm39)	V47I	probably benign	Het
Nudt3	A	G	17: 27,799,782 (GRCm39)	S134P	possibly damaging	Het
Or1e26	C	A	11: 73,479,839 (GRCm39)	G242C	probably damaging	Het
Or1e26	A	T	11: 73,480,194 (GRCm39)	Y123*	probably null	Het
Or5g9	G	A	2: 85,552,040 (GRCm39)	C97Y	probably damaging	Het
Pcnx1	A	G	12: 82,042,892 (GRCm39)	T2325A	probably benign	Het
Phactr4	A	T	4: 132,095,178 (GRCm39)		probably null	Het
Rnf7l	T	A	10: 63,257,472 (GRCm39)	H16L	probably benign	Het
Serpinb6d	T	A	13: 33,848,097 (GRCm39)	D20E	probably benign	Het
Spta1	A	T	1: 174,035,880 (GRCm39)	Y1062F	probably damaging	Het
Ssc5d	A	G	7: 4,945,790 (GRCm39)	T941A	probably benign	Het
Tax1bp1	A	G	6: 52,716,533 (GRCm39)	H286R	probably damaging	Het
Tmem62	T	A	2: 120,807,948 (GRCm39)	W57R	probably damaging	Het
Vmn2r111	T	C	17: 22,790,301 (GRCm39)	Y235C	possibly damaging	Het
Vmn2r22	T	A	6: 123,627,591 (GRCm39)	K2*	probably null	Het
Vmn2r74	A	G	7: 85,605,322 (GRCm39)	V442A	probably benign	Het

Other mutations in Taf11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0115:Taf11	UTSW	17	28,126,635 (GRCm39)	missense	probably benign
R1627:Taf11	UTSW	17	28,124,253 (GRCm39)	missense	probably benign	0.02
R4126:Taf11	UTSW	17	28,120,746 (GRCm39)	missense	possibly damaging	0.71
R5861:Taf11	UTSW	17	28,120,644 (GRCm39)	missense	probably benign	0.00
R6789:Taf11	UTSW	17	28,126,492 (GRCm39)	missense	probably benign	0.00
R8500:Taf11	UTSW	17	28,121,594 (GRCm39)	missense	probably damaging	1.00
R9714:Taf11	UTSW	17	28,122,136 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACACAGCTGTTGCACTGTAG -3'
(R):5'- CTCTTAGAACAAGCAAAGGGC -3'

Sequencing Primer
(F):5'- AAGCTGACCTGCGATACA -3'
(R):5'- GCCAGCTGCTTCTGTCTAATG -3'

Posted On

2015-03-25