Incidental Mutation 'R3783:Psg27'
ID272120
Institutional Source Beutler Lab
Gene Symbol Psg27
Ensembl Gene ENSMUSG00000070797
Gene Namepregnancy-specific glycoprotein 27
SynonymsEG545925, cea15
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location18556514-18567305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18560354 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 376 (Q376L)
Ref Sequence ENSEMBL: ENSMUSP00000092388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094794]
Predicted Effect probably damaging
Transcript: ENSMUST00000094794
AA Change: Q376L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092388
Gene: ENSMUSG00000070797
AA Change: Q376L

DomainStartEndE-ValueType
IG 39 140 4.13e-5 SMART
IG 159 260 5.89e-1 SMART
IG 279 380 1.39e-2 SMART
IGc2 396 460 3.62e-10 SMART
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Psg27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Psg27 APN 7 18561804 missense probably damaging 1.00
IGL00417:Psg27 APN 7 18561917 missense probably benign 0.22
IGL01344:Psg27 APN 7 18560417 missense probably damaging 1.00
IGL01781:Psg27 APN 7 18565064 missense probably damaging 1.00
IGL02547:Psg27 APN 7 18560628 missense probably benign
IGL02926:Psg27 APN 7 18557129 missense probably damaging 0.99
IGL03074:Psg27 APN 7 18560529 missense probably benign 0.02
IGL03237:Psg27 APN 7 18560492 missense probably benign 0.00
IGL02796:Psg27 UTSW 7 18561950 missense probably benign 0.08
R0437:Psg27 UTSW 7 18560711 splice site probably benign
R0604:Psg27 UTSW 7 18557072 missense probably damaging 0.98
R1163:Psg27 UTSW 7 18565309 missense probably damaging 0.99
R2072:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2072:Psg27 UTSW 7 18565009 missense probably benign 0.16
R2073:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2074:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2081:Psg27 UTSW 7 18556958 missense probably damaging 1.00
R2206:Psg27 UTSW 7 18567111 nonsense probably null
R2866:Psg27 UTSW 7 18561893 missense probably benign
R3784:Psg27 UTSW 7 18560354 missense probably damaging 1.00
R4463:Psg27 UTSW 7 18557085 missense possibly damaging 0.46
R5312:Psg27 UTSW 7 18557033 missense probably benign 0.43
R5885:Psg27 UTSW 7 18561786 missense probably damaging 0.96
R6087:Psg27 UTSW 7 18556944 missense probably benign 0.05
X0064:Psg27 UTSW 7 18561795 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGACCACCCCATGTGTAC -3'
(R):5'- ATCCACAAGCCTTTTCCTGG -3'

Sequencing Primer
(F):5'- CCATGTGTACCCAGCTGTAAGTG -3'
(R):5'- CAAGCCTTTTCCTGGTACAAAGG -3'
Posted On2015-03-25