Incidental Mutation 'R3783:Wap'
ID272127
Institutional Source Beutler Lab
Gene Symbol Wap
Ensembl Gene ENSMUSG00000000381
Gene Namewhey acidic protein
Synonyms
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6635482-6638637 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 6638550 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 25 (Q25*)
Ref Sequence ENSEMBL: ENSMUSP00000099974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102910]
Predicted Effect probably null
Transcript: ENSMUST00000102910
AA Change: Q25*
SMART Domains Protein: ENSMUSP00000099974
Gene: ENSMUSG00000000381
AA Change: Q25*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
internal_repeat_1 46 75 4.46e-5 PROSPERO
WAP 79 128 1.96e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141868
Meta Mutation Damage Score 0.6312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype PHENOTYPE: Homozygous mutants are phenotypically normal and fertile. Functional differentiation of mammary epithelium is normal and dams produce milk, but pups thrive poorly on milk lacking whey acidic protein. A normal variant determines a one amino acid change inWAP protein in YBR versus other strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Wap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Wap APN 11 6636808 missense probably damaging 0.98
R0899:Wap UTSW 11 6636725 missense probably benign 0.00
R1330:Wap UTSW 11 6636818 missense unknown
R3785:Wap UTSW 11 6638550 nonsense probably null
R3786:Wap UTSW 11 6638550 nonsense probably null
R3787:Wap UTSW 11 6638550 nonsense probably null
R5022:Wap UTSW 11 6637339 splice site probably benign
R5065:Wap UTSW 11 6636840 missense probably damaging 0.96
R5664:Wap UTSW 11 6638609 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TACAGCTTGTGTGGGACAGG -3'
(R):5'- TCTCTGTGTGGCCAAGAAGG -3'

Sequencing Primer
(F):5'- GGACAGGCCCCTACTTCC -3'
(R):5'- AAGTGTTGTAGCCCATCTAGAGC -3'
Posted On2015-03-25