Incidental Mutation 'R3784:Spats2l'
ID272153
Institutional Source Beutler Lab
Gene Symbol Spats2l
Ensembl Gene ENSMUSG00000038305
Gene Namespermatogenesis associated, serine-rich 2-like
SynonymsA230104H11Rik, 2810022L02Rik
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location57774162-57948394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57885779 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 112 (E112G)
Ref Sequence ENSEMBL: ENSMUSP00000126166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163239] [ENSMUST00000164302] [ENSMUST00000167085] [ENSMUST00000167971] [ENSMUST00000169772] [ENSMUST00000170139] [ENSMUST00000171699] [ENSMUST00000172068] [ENSMUST00000172287]
Predicted Effect probably benign
Transcript: ENSMUST00000163239
SMART Domains Protein: ENSMUSP00000128992
Gene: ENSMUSG00000038305

DomainStartEndE-ValueType
Pfam:DUF1387 1 261 9.7e-124 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164302
AA Change: E92G

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132592
Gene: ENSMUSG00000038305
AA Change: E92G

DomainStartEndE-ValueType
Pfam:DUF1387 59 149 3.6e-25 PFAM
Pfam:DUF1387 146 299 1.6e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167085
AA Change: E112G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133054
Gene: ENSMUSG00000038305
AA Change: E112G

DomainStartEndE-ValueType
Pfam:DUF1387 79 388 1.8e-130 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167971
AA Change: E112G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128764
Gene: ENSMUSG00000038305
AA Change: E112G

DomainStartEndE-ValueType
Pfam:DUF1387 79 130 4.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169772
AA Change: E92G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132975
Gene: ENSMUSG00000038305
AA Change: E92G

DomainStartEndE-ValueType
Pfam:DUF1387 59 368 5.6e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170139
AA Change: E92G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127598
Gene: ENSMUSG00000038305
AA Change: E92G

DomainStartEndE-ValueType
Pfam:DUF1387 59 368 5.6e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171699
AA Change: E112G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128239
Gene: ENSMUSG00000038305
AA Change: E112G

DomainStartEndE-ValueType
Pfam:DUF1387 79 169 1.2e-25 PFAM
Pfam:DUF1387 167 270 2e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172068
AA Change: E112G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126166
Gene: ENSMUSG00000038305
AA Change: E112G

DomainStartEndE-ValueType
Pfam:DUF1387 79 244 5e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172287
SMART Domains Protein: ENSMUSP00000131125
Gene: ENSMUSG00000038305

DomainStartEndE-ValueType
low complexity region 84 96 N/A INTRINSIC
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Spats2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Spats2l APN 1 57943072 missense probably damaging 1.00
IGL00788:Spats2l APN 1 57885705 missense probably damaging 1.00
IGL01627:Spats2l APN 1 57902082 splice site probably benign
IGL01758:Spats2l APN 1 57879556 missense probably damaging 1.00
IGL03395:Spats2l APN 1 57938016 missense probably damaging 1.00
P0033:Spats2l UTSW 1 57885838 missense probably damaging 0.99
R0762:Spats2l UTSW 1 57885884 missense possibly damaging 0.88
R1167:Spats2l UTSW 1 57943111 missense probably damaging 1.00
R1486:Spats2l UTSW 1 57900811 missense probably damaging 0.99
R1564:Spats2l UTSW 1 57946224 missense probably damaging 1.00
R1938:Spats2l UTSW 1 57885782 missense probably benign 0.32
R2071:Spats2l UTSW 1 57940464 missense possibly damaging 0.90
R2096:Spats2l UTSW 1 57946299 missense probably benign 0.00
R2215:Spats2l UTSW 1 57946416 missense possibly damaging 0.82
R3053:Spats2l UTSW 1 57900766 missense probably damaging 1.00
R4814:Spats2l UTSW 1 57937926 missense possibly damaging 0.83
R4915:Spats2l UTSW 1 57902188 missense probably damaging 1.00
R4962:Spats2l UTSW 1 57885824 missense possibly damaging 0.88
R5022:Spats2l UTSW 1 57879556 missense probably damaging 1.00
R5068:Spats2l UTSW 1 57943221 missense probably benign
R5561:Spats2l UTSW 1 57900621 splice site probably null
R5773:Spats2l UTSW 1 57879549 missense possibly damaging 0.86
R5885:Spats2l UTSW 1 57946162 missense probably damaging 0.96
R6136:Spats2l UTSW 1 57902143 missense probably damaging 1.00
R6651:Spats2l UTSW 1 57946177 missense probably damaging 1.00
R6929:Spats2l UTSW 1 57879536 missense probably damaging 1.00
X0054:Spats2l UTSW 1 57943243 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGATGTGCTCTCACCCGTTC -3'
(R):5'- GCCACTGCTTCAATCAGCTC -3'

Sequencing Primer
(F):5'- CCGTTCTATTAAAACCCAGGTGTCAG -3'
(R):5'- GATACCCAAGAACTGACCTGTG -3'
Posted On2015-03-25