Incidental Mutation 'R3784:Prrc2c'
ID272154
Institutional Source Beutler Lab
Gene Symbol Prrc2c
Ensembl Gene ENSMUSG00000040225
Gene Nameproline-rich coiled-coil 2C
Synonyms9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162670725-162740556 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 162709669 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028016] [ENSMUST00000182149] [ENSMUST00000182393] [ENSMUST00000182593] [ENSMUST00000182660] [ENSMUST00000183011] [ENSMUST00000183223]
Predicted Effect unknown
Transcript: ENSMUST00000028016
AA Change: T604A
SMART Domains Protein: ENSMUSP00000028016
Gene: ENSMUSG00000040225
AA Change: T604A

DomainStartEndE-ValueType
Pfam:BAT2_N 1 164 7.7e-56 PFAM
internal_repeat_2 167 349 4.39e-5 PROSPERO
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182149
AA Change: T606A
SMART Domains Protein: ENSMUSP00000138548
Gene: ENSMUSG00000040225
AA Change: T606A

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 5.6e-73 PFAM
internal_repeat_1 336 391 1.49e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
internal_repeat_3 754 925 9.16e-5 PROSPERO
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 1.49e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 3.08e-5 PROSPERO
internal_repeat_3 1983 2153 9.16e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182393
SMART Domains Protein: ENSMUSP00000138451
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
low complexity region 24 51 N/A INTRINSIC
low complexity region 104 125 N/A INTRINSIC
low complexity region 431 462 N/A INTRINSIC
low complexity region 481 519 N/A INTRINSIC
low complexity region 531 548 N/A INTRINSIC
low complexity region 560 625 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 946 968 N/A INTRINSIC
low complexity region 988 1002 N/A INTRINSIC
low complexity region 1037 1054 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1274 1297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182448
Predicted Effect unknown
Transcript: ENSMUST00000182593
AA Change: T604A
SMART Domains Protein: ENSMUSP00000138674
Gene: ENSMUSG00000040225
AA Change: T604A

DomainStartEndE-ValueType
Pfam:BAT2_N 1 165 4.1e-70 PFAM
internal_repeat_1 334 389 9.57e-6 PROSPERO
low complexity region 405 412 N/A INTRINSIC
SCOP:d1eq1a_ 445 589 3e-5 SMART
low complexity region 647 667 N/A INTRINSIC
low complexity region 731 743 N/A INTRINSIC
internal_repeat_3 752 923 6.11e-5 PROSPERO
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1155 1184 N/A INTRINSIC
low complexity region 1210 1220 N/A INTRINSIC
internal_repeat_1 1238 1293 9.57e-6 PROSPERO
low complexity region 1306 1333 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1713 1744 N/A INTRINSIC
low complexity region 1763 1801 N/A INTRINSIC
low complexity region 1813 1830 N/A INTRINSIC
low complexity region 1842 1907 N/A INTRINSIC
internal_repeat_2 1960 2146 2.01e-5 PROSPERO
internal_repeat_3 1981 2151 6.11e-5 PROSPERO
low complexity region 2161 2175 N/A INTRINSIC
low complexity region 2228 2250 N/A INTRINSIC
low complexity region 2270 2284 N/A INTRINSIC
low complexity region 2319 2336 N/A INTRINSIC
low complexity region 2425 2436 N/A INTRINSIC
low complexity region 2551 2574 N/A INTRINSIC
low complexity region 2671 2682 N/A INTRINSIC
low complexity region 2730 2747 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182660
AA Change: T606A
SMART Domains Protein: ENSMUSP00000138433
Gene: ENSMUSG00000040225
AA Change: T606A

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 7e-73 PFAM
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183011
SMART Domains Protein: ENSMUSP00000138609
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 160 3.2e-64 PFAM
low complexity region 400 407 N/A INTRINSIC
coiled coil region 443 560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183223
SMART Domains Protein: ENSMUSP00000138698
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
low complexity region 289 320 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 418 483 N/A INTRINSIC
low complexity region 739 761 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
low complexity region 830 847 N/A INTRINSIC
low complexity region 936 947 N/A INTRINSIC
low complexity region 1062 1085 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1241 1258 N/A INTRINSIC
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Prrc2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Prrc2c APN 1 162720613 splice site probably null
IGL00577:Prrc2c APN 1 162698116 missense unknown
IGL00580:Prrc2c APN 1 162698116 missense unknown
IGL01295:Prrc2c APN 1 162682492 missense probably damaging 1.00
IGL01554:Prrc2c APN 1 162710786 missense probably damaging 0.99
IGL01684:Prrc2c APN 1 162706462 unclassified probably benign
IGL01745:Prrc2c APN 1 162724728 missense probably damaging 1.00
IGL01770:Prrc2c APN 1 162704499 missense probably benign 0.23
IGL01905:Prrc2c APN 1 162705329 unclassified probably benign
IGL02304:Prrc2c APN 1 162684136 missense probably benign 0.05
IGL02389:Prrc2c APN 1 162692870 missense probably damaging 1.00
IGL02540:Prrc2c APN 1 162723137 missense probably damaging 1.00
IGL02681:Prrc2c APN 1 162705612 unclassified probably benign
IGL02686:Prrc2c APN 1 162707947 unclassified probably benign
IGL02795:Prrc2c APN 1 162714299 missense probably benign
IGL02894:Prrc2c APN 1 162678057 missense probably damaging 1.00
IGL02957:Prrc2c APN 1 162706535 unclassified probably benign
IGL02981:Prrc2c APN 1 162705179 unclassified probably benign
IGL03070:Prrc2c APN 1 162677409 missense probably damaging 1.00
IGL03096:Prrc2c APN 1 162702359 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0135:Prrc2c UTSW 1 162715483 splice site probably benign
R0279:Prrc2c UTSW 1 162715464 missense probably damaging 1.00
R0363:Prrc2c UTSW 1 162697811 missense unknown
R0436:Prrc2c UTSW 1 162705314 unclassified probably benign
R0605:Prrc2c UTSW 1 162682426 missense probably damaging 1.00
R0696:Prrc2c UTSW 1 162708852 critical splice donor site probably null
R0981:Prrc2c UTSW 1 162705981 unclassified probably benign
R1693:Prrc2c UTSW 1 162718713 missense probably damaging 0.98
R1714:Prrc2c UTSW 1 162677376 missense probably damaging 1.00
R1791:Prrc2c UTSW 1 162704982 unclassified probably benign
R1794:Prrc2c UTSW 1 162705959 unclassified probably benign
R1998:Prrc2c UTSW 1 162704918 unclassified probably benign
R2040:Prrc2c UTSW 1 162697557 missense probably damaging 1.00
R2168:Prrc2c UTSW 1 162710334 unclassified probably benign
R2246:Prrc2c UTSW 1 162707791 unclassified probably benign
R2830:Prrc2c UTSW 1 162708916 unclassified probably benign
R2926:Prrc2c UTSW 1 162706127 unclassified probably benign
R3703:Prrc2c UTSW 1 162710691 missense probably damaging 1.00
R3745:Prrc2c UTSW 1 162698185 missense unknown
R3760:Prrc2c UTSW 1 162692851 missense probably damaging 1.00
R3959:Prrc2c UTSW 1 162708892 unclassified probably benign
R4255:Prrc2c UTSW 1 162706326 unclassified probably benign
R4276:Prrc2c UTSW 1 162673591 missense probably damaging 1.00
R4421:Prrc2c UTSW 1 162709061 unclassified probably benign
R4593:Prrc2c UTSW 1 162697532 missense probably damaging 1.00
R4651:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4652:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4660:Prrc2c UTSW 1 162680895 missense probably damaging 1.00
R4677:Prrc2c UTSW 1 162705179 unclassified probably benign
R4688:Prrc2c UTSW 1 162697687 missense unknown
R4753:Prrc2c UTSW 1 162691230 missense probably damaging 1.00
R4790:Prrc2c UTSW 1 162710481 missense unknown
R4981:Prrc2c UTSW 1 162692547 missense probably damaging 1.00
R4995:Prrc2c UTSW 1 162705310 unclassified probably benign
R5119:Prrc2c UTSW 1 162705440 unclassified probably benign
R5127:Prrc2c UTSW 1 162697846 missense unknown
R5291:Prrc2c UTSW 1 162705582 unclassified probably benign
R5474:Prrc2c UTSW 1 162709644 unclassified probably benign
R5543:Prrc2c UTSW 1 162673511 missense probably damaging 0.99
R5579:Prrc2c UTSW 1 162680758 critical splice donor site probably null
R5594:Prrc2c UTSW 1 162699031 missense unknown
R5620:Prrc2c UTSW 1 162673529 missense probably damaging 1.00
R5994:Prrc2c UTSW 1 162674156 splice site probably null
R6142:Prrc2c UTSW 1 162710387 missense unknown
R6199:Prrc2c UTSW 1 162682516 missense probably damaging 1.00
R6277:Prrc2c UTSW 1 162714314 missense probably benign
R6504:Prrc2c UTSW 1 162697795 missense unknown
R6671:Prrc2c UTSW 1 162697585 missense probably damaging 1.00
R6785:Prrc2c UTSW 1 162709101 unclassified probably benign
R6799:Prrc2c UTSW 1 162709061 unclassified probably benign
R6801:Prrc2c UTSW 1 162709061 unclassified probably benign
R6850:Prrc2c UTSW 1 162709061 unclassified probably benign
R6851:Prrc2c UTSW 1 162709061 unclassified probably benign
R6856:Prrc2c UTSW 1 162682371 missense probably damaging 1.00
R6869:Prrc2c UTSW 1 162709061 unclassified probably benign
R6882:Prrc2c UTSW 1 162709061 unclassified probably benign
R6884:Prrc2c UTSW 1 162709061 unclassified probably benign
R6897:Prrc2c UTSW 1 162705506 unclassified probably benign
R6934:Prrc2c UTSW 1 162720505 missense probably benign 0.10
R6976:Prrc2c UTSW 1 162692844 missense probably damaging 1.00
X0020:Prrc2c UTSW 1 162707847 unclassified probably benign
X0039:Prrc2c UTSW 1 162704793 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACAGAGTTGGCAAAAGACC -3'
(R):5'- ATCTGTGTTCTCCTTAGAGTCCAG -3'

Sequencing Primer
(F):5'- GCATCTCATCATTTCCTAGAAGTAG -3'
(R):5'- TCTCCTTAGAGTCCAGGTTTATAAG -3'
Posted On2015-03-25