Incidental Mutation 'R3784:Iars2'
ID272156
Institutional Source Beutler Lab
Gene Symbol Iars2
Ensembl Gene ENSMUSG00000026618
Gene Nameisoleucine-tRNA synthetase 2, mitochondrial
Synonyms2010002H18Rik
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location185284726-185329396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 185287131 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 986 (K986R)
Ref Sequence ENSEMBL: ENSMUSP00000027921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027921] [ENSMUST00000069652] [ENSMUST00000194740]
Predicted Effect probably benign
Transcript: ENSMUST00000027921
AA Change: K986R

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027921
Gene: ENSMUSG00000026618
AA Change: K986R

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:tRNA-synt_1 87 712 3.6e-172 PFAM
Pfam:tRNA-synt_1g 112 268 7e-15 PFAM
Pfam:tRNA-synt_1_2 334 462 3.8e-7 PFAM
Pfam:Anticodon_1 756 920 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069652
SMART Domains Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-167 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 767 1366 3.2e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193482
Predicted Effect probably benign
Transcript: ENSMUST00000194740
SMART Domains Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-157 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 766 1346 2.5e-233 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195042
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of isoleucine-tRNA synthetase exist, a cytoplasmic form and a mitochondrial form. This gene encodes the mitochondrial isoleucine-tRNA synthetase which belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Iars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Iars2 APN 1 185315954 missense probably benign 0.00
IGL00906:Iars2 APN 1 185296403 splice site probably benign
IGL01287:Iars2 APN 1 185296428 missense possibly damaging 0.90
IGL01814:Iars2 APN 1 185302775 nonsense probably null
IGL02016:Iars2 APN 1 185303306 missense probably damaging 0.99
IGL02995:Iars2 APN 1 185303301 missense probably benign
IGL03002:Iars2 APN 1 185322816 splice site probably null
IGL03248:Iars2 APN 1 185291432 unclassified probably benign
R0304:Iars2 UTSW 1 185287156 missense possibly damaging 0.77
R0711:Iars2 UTSW 1 185322388 splice site probably benign
R0783:Iars2 UTSW 1 185320874 missense probably damaging 1.00
R0990:Iars2 UTSW 1 185318627 missense probably damaging 1.00
R1867:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1868:Iars2 UTSW 1 185318568 missense probably benign 0.01
R1957:Iars2 UTSW 1 185295671 missense possibly damaging 0.89
R2378:Iars2 UTSW 1 185327721 missense probably damaging 1.00
R4061:Iars2 UTSW 1 185303386 missense possibly damaging 0.85
R4334:Iars2 UTSW 1 185303394 missense probably benign 0.35
R4708:Iars2 UTSW 1 185289357 missense probably benign 0.00
R4723:Iars2 UTSW 1 185315979 missense probably damaging 1.00
R4729:Iars2 UTSW 1 185316051 missense possibly damaging 0.71
R4851:Iars2 UTSW 1 185327648 missense probably damaging 0.99
R5033:Iars2 UTSW 1 185317928 missense possibly damaging 0.65
R5215:Iars2 UTSW 1 185294769 missense probably damaging 1.00
R5260:Iars2 UTSW 1 185323734 missense probably damaging 1.00
R5286:Iars2 UTSW 1 185323121 intron probably benign
R5614:Iars2 UTSW 1 185289508 missense probably benign 0.00
R6659:Iars2 UTSW 1 185288076 missense possibly damaging 0.76
R6838:Iars2 UTSW 1 185329145 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTGGATTTCTTTCTAGGGAACTG -3'
(R):5'- ATGTTAGACACGTGGGAGGC -3'

Sequencing Primer
(F):5'- GATTTCTTTCTAGGGAACTGTCTAAC -3'
(R):5'- TTGGGAGGAGCGTCCAC -3'
Posted On2015-03-25