Incidental Mutation 'R3784:Cfap206'
ID272162
Institutional Source Beutler Lab
Gene Symbol Cfap206
Ensembl Gene ENSMUSG00000028294
Gene Namecilia and flagella associated protein 206
Synonyms1700003M02Rik
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location34688559-34730206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34716445 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 340 (I340N)
Ref Sequence ENSEMBL: ENSMUSP00000103771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029971] [ENSMUST00000108136] [ENSMUST00000137514] [ENSMUST00000162495]
Predicted Effect probably damaging
Transcript: ENSMUST00000029971
AA Change: I340N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029971
Gene: ENSMUSG00000028294
AA Change: I340N

DomainStartEndE-ValueType
Pfam:DUF3508 214 491 6.1e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108136
AA Change: I340N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103771
Gene: ENSMUSG00000028294
AA Change: I340N

DomainStartEndE-ValueType
Pfam:DUF3508 213 493 3.8e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135563
Predicted Effect probably benign
Transcript: ENSMUST00000137514
Predicted Effect probably benign
Transcript: ENSMUST00000162495
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Cfap206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00798:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00826:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00919:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01062:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01064:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01069:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01070:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01086:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01087:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01090:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01098:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01111:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01133:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01135:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01147:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01152:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01153:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01154:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01155:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01289:Cfap206 APN 4 34716469 missense probably null 0.98
IGL01845:Cfap206 APN 4 34719610 missense possibly damaging 0.57
IGL02115:Cfap206 APN 4 34722623 missense possibly damaging 0.54
IGL03241:Cfap206 APN 4 34711553 missense probably damaging 1.00
IGL03405:Cfap206 APN 4 34716445 missense possibly damaging 0.82
ANU05:Cfap206 UTSW 4 34721562 missense probably damaging 1.00
R0012:Cfap206 UTSW 4 34714519 missense possibly damaging 0.76
R0689:Cfap206 UTSW 4 34722668 missense probably benign 0.23
R0730:Cfap206 UTSW 4 34711391 missense probably benign
R1567:Cfap206 UTSW 4 34716490 missense probably benign 0.01
R1694:Cfap206 UTSW 4 34719058 missense probably damaging 1.00
R1706:Cfap206 UTSW 4 34688875 missense probably damaging 1.00
R1837:Cfap206 UTSW 4 34728813 missense probably damaging 1.00
R1909:Cfap206 UTSW 4 34722714 missense probably benign
R2098:Cfap206 UTSW 4 34719053 nonsense probably null
R2568:Cfap206 UTSW 4 34711566 nonsense probably null
R3125:Cfap206 UTSW 4 34716310 missense possibly damaging 0.48
R5249:Cfap206 UTSW 4 34714502 missense probably benign
R5483:Cfap206 UTSW 4 34711404 missense probably benign 0.39
R5569:Cfap206 UTSW 4 34724892 missense probably damaging 1.00
R6247:Cfap206 UTSW 4 34692530 missense probably benign
R6555:Cfap206 UTSW 4 34719049 missense probably damaging 1.00
R6791:Cfap206 UTSW 4 34711414 missense possibly damaging 0.76
R6865:Cfap206 UTSW 4 34714448 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GAGTGACTTTAAGCTAACGGTCAC -3'
(R):5'- CTGGTGTGACAAGACTAGGACC -3'

Sequencing Primer
(F):5'- TAAGCTAACGGTCACCTTAAAGAG -3'
(R):5'- GGACCTGTAGACAAATGAGTTTC -3'
Posted On2015-03-25