Incidental Mutation 'R3784:Hook1'
ID272163
Institutional Source Beutler Lab
Gene Symbol Hook1
Ensembl Gene ENSMUSG00000028572
Gene Namehook microtubule tethering protein 1
Synonymsazh, A930033L17Rik, abnormal spermatozoon head shape
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.629) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location95967240-96025413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95989651 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 55 (F55L)
Ref Sequence ENSEMBL: ENSMUSP00000030306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030306] [ENSMUST00000107083]
PDB Structure
The solution structure of RSGI RUH-026, conserved domain of HOOK1 protein from mouse [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000030306
AA Change: F55L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030306
Gene: ENSMUSG00000028572
AA Change: F55L

DomainStartEndE-ValueType
Pfam:HOOK 14 720 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107083
AA Change: F55L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102698
Gene: ENSMUSG00000028572
AA Change: F55L

DomainStartEndE-ValueType
Pfam:HOOK 7 219 2e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141448
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook family of coiled-coil proteins, which bind to microtubules and organelles through their N- and C-terminal domains, respectively. The encoded protein localizes to discrete punctuate subcellular structures, and interacts with several members of the Rab GTPase family involved in endocytosis. It is thought to link endocytic membrane trafficking to the microtubule cytoskeleton. Several alternatively spliced transcript variants have been identified, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice have abnormal ladle shaped sperm with up to 40% lacking a flagella. Nonetheless, most males breed, although litter size is reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Hook1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Hook1 APN 4 96022197 missense probably benign 0.25
IGL02229:Hook1 APN 4 96001251 missense possibly damaging 0.93
IGL03338:Hook1 APN 4 95998692 splice site probably benign
R0558:Hook1 UTSW 4 95993212 splice site probably benign
R0593:Hook1 UTSW 4 95998786 missense possibly damaging 0.93
R0699:Hook1 UTSW 4 95995840 splice site probably benign
R1004:Hook1 UTSW 4 96022287 missense probably benign 0.00
R1465:Hook1 UTSW 4 96013256 missense probably benign 0.00
R1465:Hook1 UTSW 4 96013256 missense probably benign 0.00
R2140:Hook1 UTSW 4 96013312 frame shift probably null
R2278:Hook1 UTSW 4 95998720 missense probably benign 0.00
R4500:Hook1 UTSW 4 95993200 critical splice donor site probably null
R4798:Hook1 UTSW 4 96002557 missense possibly damaging 0.84
R5200:Hook1 UTSW 4 95993130 missense probably damaging 1.00
R5546:Hook1 UTSW 4 96002528 missense probably benign 0.03
R6532:Hook1 UTSW 4 96019756 intron probably null
R6629:Hook1 UTSW 4 96001270 missense probably benign 0.03
X0027:Hook1 UTSW 4 95995811 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAAGCATTGGTTAAATTGCAAGTTA -3'
(R):5'- ACCAAAAGCAGTAAAACAGTTCT -3'

Sequencing Primer
(F):5'- GCTAATCTCACTAAGGATAGCT -3'
(R):5'- GCCAATCTGATGGAGGCATTTCC -3'
Posted On2015-03-25