Incidental Mutation 'R3784:Psg27'
ID272169
Institutional Source Beutler Lab
Gene Symbol Psg27
Ensembl Gene ENSMUSG00000070797
Gene Namepregnancy-specific glycoprotein 27
SynonymsEG545925, cea15
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location18556514-18567305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18560354 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 376 (Q376L)
Ref Sequence ENSEMBL: ENSMUSP00000092388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094794]
Predicted Effect probably damaging
Transcript: ENSMUST00000094794
AA Change: Q376L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092388
Gene: ENSMUSG00000070797
AA Change: Q376L

DomainStartEndE-ValueType
IG 39 140 4.13e-5 SMART
IG 159 260 5.89e-1 SMART
IG 279 380 1.39e-2 SMART
IGc2 396 460 3.62e-10 SMART
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Psg27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Psg27 APN 7 18561804 missense probably damaging 1.00
IGL00417:Psg27 APN 7 18561917 missense probably benign 0.22
IGL01344:Psg27 APN 7 18560417 missense probably damaging 1.00
IGL01781:Psg27 APN 7 18565064 missense probably damaging 1.00
IGL02547:Psg27 APN 7 18560628 missense probably benign
IGL02926:Psg27 APN 7 18557129 missense probably damaging 0.99
IGL03074:Psg27 APN 7 18560529 missense probably benign 0.02
IGL03237:Psg27 APN 7 18560492 missense probably benign 0.00
IGL02796:Psg27 UTSW 7 18561950 missense probably benign 0.08
R0437:Psg27 UTSW 7 18560711 splice site probably benign
R0604:Psg27 UTSW 7 18557072 missense probably damaging 0.98
R1163:Psg27 UTSW 7 18565309 missense probably damaging 0.99
R2072:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2072:Psg27 UTSW 7 18565009 missense probably benign 0.16
R2073:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2074:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2081:Psg27 UTSW 7 18556958 missense probably damaging 1.00
R2206:Psg27 UTSW 7 18567111 nonsense probably null
R2866:Psg27 UTSW 7 18561893 missense probably benign
R3783:Psg27 UTSW 7 18560354 missense probably damaging 1.00
R4463:Psg27 UTSW 7 18557085 missense possibly damaging 0.46
R5312:Psg27 UTSW 7 18557033 missense probably benign 0.43
R5885:Psg27 UTSW 7 18561786 missense probably damaging 0.96
R6087:Psg27 UTSW 7 18556944 missense probably benign 0.05
X0064:Psg27 UTSW 7 18561795 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAATGCTGTTGGACCACCC -3'
(R):5'- TTTTCCTGGTACAAAGGCGTAG -3'

Sequencing Primer
(F):5'- CCATGTGTACCCAGCTGTAAGTG -3'
(R):5'- TTTCCTGGTACAAAGGCGTAGATAGC -3'
Posted On2015-03-25