Incidental Mutation 'R3784:Armc2'
ID272174
Institutional Source Beutler Lab
Gene Symbol Armc2
Ensembl Gene ENSMUSG00000071324
Gene Namearmadillo repeat containing 2
Synonyms
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location41914990-42018442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41922194 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 779 (I779V)
Ref Sequence ENSEMBL: ENSMUSP00000125412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095729] [ENSMUST00000160262] [ENSMUST00000161927]
Predicted Effect probably benign
Transcript: ENSMUST00000095729
AA Change: I779V

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093397
Gene: ENSMUSG00000071324
AA Change: I779V

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 222 237 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 324 336 N/A INTRINSIC
ARM 355 393 7.53e1 SMART
ARM 400 453 3.69e1 SMART
ARM 454 496 8.23e1 SMART
Blast:ARM 497 540 1e-16 BLAST
Blast:ARM 542 603 1e-6 BLAST
Blast:ARM 603 649 7e-20 BLAST
Blast:ARM 653 692 3e-8 BLAST
ARM 693 733 4.41e1 SMART
ARM 734 777 2.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105503
Predicted Effect probably benign
Transcript: ENSMUST00000160262
AA Change: I779V

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125412
Gene: ENSMUSG00000071324
AA Change: I779V

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 222 237 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 324 336 N/A INTRINSIC
ARM 355 393 7.53e1 SMART
ARM 400 453 3.69e1 SMART
ARM 454 496 8.23e1 SMART
Blast:ARM 497 540 1e-16 BLAST
Blast:ARM 542 603 1e-6 BLAST
Blast:ARM 603 649 7e-20 BLAST
Blast:ARM 653 692 3e-8 BLAST
ARM 693 733 4.41e1 SMART
ARM 734 777 2.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160367
Predicted Effect probably benign
Transcript: ENSMUST00000161927
SMART Domains Protein: ENSMUSP00000124049
Gene: ENSMUSG00000071324

DomainStartEndE-ValueType
low complexity region 58 75 N/A INTRINSIC
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Armc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Armc2 UTSW 10 41947887 splice site probably benign
R0144:Armc2 UTSW 10 41947887 splice site probably benign
R0427:Armc2 UTSW 10 42000410 missense possibly damaging 0.87
R0540:Armc2 UTSW 10 41922695 missense probably benign 0.11
R0561:Armc2 UTSW 10 41993192 missense probably benign 0.02
R0607:Armc2 UTSW 10 41922695 missense probably benign 0.11
R1099:Armc2 UTSW 10 41917187 missense probably benign 0.39
R1130:Armc2 UTSW 10 42011834 missense possibly damaging 0.85
R2116:Armc2 UTSW 10 41963667 missense probably damaging 0.98
R2870:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2870:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2871:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2871:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2872:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2872:Armc2 UTSW 10 41966700 critical splice donor site probably null
R2873:Armc2 UTSW 10 41966700 critical splice donor site probably null
R3083:Armc2 UTSW 10 41966730 missense probably damaging 1.00
R3771:Armc2 UTSW 10 41922227 missense probably damaging 1.00
R3880:Armc2 UTSW 10 41963725 missense possibly damaging 0.71
R4024:Armc2 UTSW 10 41993058 missense probably benign
R4155:Armc2 UTSW 10 42011867 missense probably damaging 0.96
R4370:Armc2 UTSW 10 41917200 missense probably benign 0.13
R4378:Armc2 UTSW 10 41993082 missense possibly damaging 0.66
R4896:Armc2 UTSW 10 41923794 missense probably damaging 1.00
R5119:Armc2 UTSW 10 41922148 missense probably damaging 1.00
R5159:Armc2 UTSW 10 42008715 missense probably damaging 0.96
R5517:Armc2 UTSW 10 41963850 missense probably benign 0.29
R5640:Armc2 UTSW 10 42011898 missense possibly damaging 0.87
R5767:Armc2 UTSW 10 42011927 missense probably benign 0.02
R5965:Armc2 UTSW 10 41922572 missense possibly damaging 0.94
R6897:Armc2 UTSW 10 41993229 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCGTCAAGTCCTTTCACAGTCC -3'
(R):5'- AGAAGCCCAGCCGTTATGATAAC -3'

Sequencing Primer
(F):5'- ACAGTCCCTTCTCCAAGTGATAATC -3'
(R):5'- GCCGTTATGATAACAATCTAAAACCC -3'
Posted On2015-03-25