Incidental Mutation 'R3784:Tekt1'
ID272177
Institutional Source Beutler Lab
Gene Symbol Tekt1
Ensembl Gene ENSMUSG00000020799
Gene Nametektin 1
SynonymsMT14
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72344722-72362442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72344894 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 376 (I376T)
Ref Sequence ENSEMBL: ENSMUSP00000104143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021155] [ENSMUST00000108502] [ENSMUST00000108503]
Predicted Effect probably damaging
Transcript: ENSMUST00000021155
AA Change: I376T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021155
Gene: ENSMUSG00000020799
AA Change: I376T

DomainStartEndE-ValueType
Pfam:Tektin 16 398 1.3e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108502
AA Change: I376T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104142
Gene: ENSMUSG00000020799
AA Change: I376T

DomainStartEndE-ValueType
Pfam:Tektin 16 399 5.5e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108503
AA Change: I376T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104143
Gene: ENSMUSG00000020799
AA Change: I376T

DomainStartEndE-ValueType
Pfam:Tektin 16 399 5.5e-152 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158122
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is predominantly expressed in the testis and in mouse, tektin 1 mRNA was localized to the spermatocytes and round spermatids in the seminiferous tubules, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Tekt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0463:Tekt1 UTSW 11 72351952 missense probably damaging 1.00
R0531:Tekt1 UTSW 11 72345594 missense possibly damaging 0.67
R1190:Tekt1 UTSW 11 72355213 missense probably damaging 1.00
R1908:Tekt1 UTSW 11 72351935 missense probably benign 0.41
R3783:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3785:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3787:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3831:Tekt1 UTSW 11 72354819 missense probably benign 0.03
R3832:Tekt1 UTSW 11 72354819 missense probably benign 0.03
R3833:Tekt1 UTSW 11 72354819 missense probably benign 0.03
R3916:Tekt1 UTSW 11 72345748 missense possibly damaging 0.83
R3917:Tekt1 UTSW 11 72345748 missense possibly damaging 0.83
R5645:Tekt1 UTSW 11 72351837 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCCACCTGAAATGAGAGCTCTG -3'
(R):5'- CACTGCCTAGAGAAGCAAGG -3'

Sequencing Primer
(F):5'- GTGCTAACTCTTGTCTTACGATGCAG -3'
(R):5'- TGTGATTATCCCTCACGC -3'
Posted On2015-03-25