Incidental Mutation 'R3784:Taf15'
ID272179
Institutional Source Beutler Lab
Gene Symbol Taf15
Ensembl Gene ENSMUSG00000020680
Gene NameTATA-box binding protein associated factor 15
SynonymsTAFII68, 2610111C21Rik, Taf2n, 68kDa
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83473086-83506743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83506422 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 313 (D313N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021018]
Predicted Effect unknown
Transcript: ENSMUST00000021018
AA Change: D547N
SMART Domains Protein: ENSMUSP00000021018
Gene: ENSMUSG00000020680
AA Change: D547N

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 44 70 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 103 128 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 173 194 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
RRM 233 314 1.34e-15 SMART
low complexity region 324 349 N/A INTRINSIC
ZnF_RBZ 354 380 1.62e-5 SMART
low complexity region 388 540 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133170
AA Change: D313N
SMART Domains Protein: ENSMUSP00000119836
Gene: ENSMUSG00000020680
AA Change: D313N

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
RRM 40 121 1.34e-15 SMART
low complexity region 131 156 N/A INTRINSIC
ZnF_RBZ 161 187 1.62e-5 SMART
low complexity region 195 312 N/A INTRINSIC
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TET family of RNA-binding proteins. The encoded protein plays a role in RNA polymerase II gene transcription as a component of a distinct subset of multi-subunit transcription initiation factor TFIID complexes. Translocations involving this gene play a role in acute leukemia and extraskeletal myxoid chondrosarcoma, and mutations in this gene may play a role in amyotrophic lateral sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Taf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Taf15 APN 11 83488923 critical splice acceptor site probably null
IGL01151:Taf15 APN 11 83487371 missense possibly damaging 0.93
R0942:Taf15 UTSW 11 83499106 missense probably damaging 1.00
R1530:Taf15 UTSW 11 83487296 missense possibly damaging 0.86
R2267:Taf15 UTSW 11 83497262 missense probably damaging 0.98
R2437:Taf15 UTSW 11 83504753 intron probably benign
R3123:Taf15 UTSW 11 83504328 critical splice donor site probably null
R3155:Taf15 UTSW 11 83502773 missense probably benign 0.03
R4491:Taf15 UTSW 11 83484694 missense probably benign 0.08
R4951:Taf15 UTSW 11 83484811 missense possibly damaging 0.64
R5104:Taf15 UTSW 11 83487396 missense probably damaging 1.00
R6814:Taf15 UTSW 11 83499089 missense probably damaging 1.00
R6987:Taf15 UTSW 11 83484695 missense possibly damaging 0.48
X0028:Taf15 UTSW 11 83487396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATGGGTAGCAAAGCCTC -3'
(R):5'- CGCACTTAGCTTTAAGGGTTAGG -3'

Sequencing Primer
(F):5'- AAAGCCTGCCTGGTCTACATAGTG -3'
(R):5'- GGACATTTCTAAAAAGAAAACTGCC -3'
Posted On2015-03-25