Incidental Mutation 'R3784:Adam11'
ID272181
Institutional Source Beutler Lab
Gene Symbol Adam11
Ensembl Gene ENSMUSG00000020926
Gene Namea disintegrin and metallopeptidase domain 11
SynonymsMdc
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102761439-102780262 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 102774367 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068150] [ENSMUST00000103081]
Predicted Effect probably null
Transcript: ENSMUST00000068150
SMART Domains Protein: ENSMUSP00000069466
Gene: ENSMUSG00000020926

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 50 193 5.7e-29 PFAM
Pfam:Reprolysin_5 241 390 2.1e-9 PFAM
Pfam:Reprolysin 243 442 1.1e-68 PFAM
Pfam:Reprolysin_3 267 378 1.3e-9 PFAM
DISIN 457 533 3.91e-36 SMART
ACR 534 673 2.76e-56 SMART
EGF 680 714 2.32e-1 SMART
transmembrane domain 740 762 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103081
SMART Domains Protein: ENSMUSP00000099370
Gene: ENSMUSG00000020926

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 193 1.1e-28 PFAM
Pfam:Reprolysin_5 241 390 2.3e-9 PFAM
Pfam:Reprolysin 243 442 5.3e-62 PFAM
Pfam:Reprolysin_3 267 385 4.5e-9 PFAM
DISIN 457 533 3.91e-36 SMART
ACR 534 673 2.76e-56 SMART
EGF 680 714 2.32e-1 SMART
transmembrane domain 740 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143269
Meta Mutation Damage Score 0.686 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit defects in spatial learning, motor coordination and altered perception of pain. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable and overtly normal but show impaired hippocampus-dependent spatial learning and cerebellum-dependent motor coordination when tested using water maze and rotating rod tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Adam11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adam11 APN 11 102776831 missense probably benign 0.40
IGL00497:Adam11 APN 11 102770147 missense probably damaging 1.00
IGL00570:Adam11 APN 11 102776350 missense possibly damaging 0.76
IGL01875:Adam11 APN 11 102772856 missense probably damaging 1.00
IGL01945:Adam11 APN 11 102772910 missense probably damaging 0.99
IGL02266:Adam11 APN 11 102772667 missense probably damaging 1.00
IGL02702:Adam11 APN 11 102777038 missense probably benign 0.26
IGL03395:Adam11 APN 11 102772920 missense probably damaging 1.00
R0091:Adam11 UTSW 11 102772839 missense probably damaging 1.00
R0135:Adam11 UTSW 11 102776573 missense probably damaging 1.00
R1068:Adam11 UTSW 11 102776378 missense probably damaging 1.00
R1529:Adam11 UTSW 11 102775113 critical splice donor site probably null
R2197:Adam11 UTSW 11 102769924 missense possibly damaging 0.94
R2357:Adam11 UTSW 11 102774508 missense probably benign
R3082:Adam11 UTSW 11 102770117 splice site probably benign
R5254:Adam11 UTSW 11 102774272 nonsense probably null
R5367:Adam11 UTSW 11 102773653 missense probably benign 0.00
R5444:Adam11 UTSW 11 102772848 missense probably damaging 1.00
R5699:Adam11 UTSW 11 102773640 missense probably benign 0.00
R5881:Adam11 UTSW 11 102773810 missense probably benign 0.17
R6193:Adam11 UTSW 11 102771261 missense probably benign
R6422:Adam11 UTSW 11 102774283 missense possibly damaging 0.95
R6798:Adam11 UTSW 11 102777008 missense probably damaging 1.00
R6822:Adam11 UTSW 11 102776675 missense possibly damaging 0.68
X0023:Adam11 UTSW 11 102774630 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTGTCGTGCAACCTCAGGG -3'
(R):5'- CGTGCGTCAAGGTGCATTTT -3'

Sequencing Primer
(F):5'- AACCTCAGGGCAGTCCTTC -3'
(R):5'- TCGGCTGCACTCCTGAG -3'
Posted On2015-03-25