Incidental Mutation 'R3784:Rad51b'
ID272185
Institutional Source Beutler Lab
Gene Symbol Rad51b
Ensembl Gene ENSMUSG00000059060
Gene NameRAD51 paralog B
SynonymsmREC2, R51H2, Rad51b
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location79297282-79814690 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 79300645 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 28 (Q28*)
Ref Sequence ENSEMBL: ENSMUSP00000152105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000079533] [ENSMUST00000171210] [ENSMUST00000218039] [ENSMUST00000218377]
Predicted Effect probably benign
Transcript: ENSMUST00000021547
SMART Domains Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
low complexity region 778 796 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
low complexity region 1073 1091 N/A INTRINSIC
low complexity region 1104 1115 N/A INTRINSIC
low complexity region 1151 1163 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
low complexity region 1228 1241 N/A INTRINSIC
low complexity region 1565 1584 N/A INTRINSIC
low complexity region 1743 1770 N/A INTRINSIC
FYVE 1794 1863 1.49e-27 SMART
low complexity region 2486 2498 N/A INTRINSIC
low complexity region 2517 2528 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079533
AA Change: Q28*
SMART Domains Protein: ENSMUSP00000078490
Gene: ENSMUSG00000059060
AA Change: Q28*

DomainStartEndE-ValueType
Pfam:Rad51 61 256 3.1e-32 PFAM
Pfam:AAA_25 68 249 1.1e-15 PFAM
Pfam:KaiC 83 240 1.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171210
AA Change: Q28*
SMART Domains Protein: ENSMUSP00000128357
Gene: ENSMUSG00000059060
AA Change: Q28*

DomainStartEndE-ValueType
Pfam:Rad51 61 256 3e-33 PFAM
Pfam:AAA_25 68 241 2.8e-16 PFAM
Pfam:KaiC 83 241 3.6e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218039
AA Change: Q28*
Predicted Effect probably benign
Transcript: ENSMUST00000218377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219842
Meta Mutation Damage Score 0.644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are evolutionarily conserved proteins essential for DNA repair by homologous recombination. This protein has been shown to form a stable heterodimer with the family member RAD51C, which further interacts with the other family members, such as RAD51, XRCC2, and XRCC3. Overexpression of this gene was found to cause cell cycle G1 delay and cell apoptosis, which suggested a role of this protein in sensing DNA damage. Rearrangements between this locus and high mobility group AT-hook 2 (HMGA2, GeneID 8091) have been observed in uterine leiomyomata. [provided by RefSeq, Mar 2016]
PHENOTYPE: Embryos homozygous for a knock-out allele are severely growth retarded and exhibit complete early embryonic lethality; interestingly, mutant embryos survive and develop further in a Trp53-null background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Rad51b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Rad51b APN 12 79302553 missense probably benign 0.00
IGL01599:Rad51b APN 12 79327228 missense probably benign 0.30
IGL02955:Rad51b APN 12 79325082 nonsense probably null
R1544:Rad51b UTSW 12 79302543 missense possibly damaging 0.87
R2998:Rad51b UTSW 12 79302489 missense probably damaging 1.00
R4076:Rad51b UTSW 12 79314882 missense probably damaging 1.00
R5916:Rad51b UTSW 12 79325082 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACATAGAGAAGTTTGAAGCAC -3'
(R):5'- CACTTCTGTACAAATGAGCTTTTCC -3'

Sequencing Primer
(F):5'- AGTTTGAAGCACTTTATTTTGTAGGG -3'
(R):5'- TGGCATCTGAGCTCAAGTC -3'
Posted On2015-03-25