Incidental Mutation 'R3784:Fam161b'
ID272186
Institutional Source Beutler Lab
Gene Symbol Fam161b
Ensembl Gene ENSMUSG00000021234
Gene Namefamily with sequence similarity 161, member B
Synonyms
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84345309-84361833 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 84361690 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021659] [ENSMUST00000021661] [ENSMUST00000065536] [ENSMUST00000110276] [ENSMUST00000110278] [ENSMUST00000152913]
Predicted Effect probably null
Transcript: ENSMUST00000021659
SMART Domains Protein: ENSMUSP00000021659
Gene: ENSMUSG00000021234

DomainStartEndE-ValueType
low complexity region 57 65 N/A INTRINSIC
low complexity region 93 107 N/A INTRINSIC
Pfam:UPF0564 168 535 5.3e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021661
SMART Domains Protein: ENSMUSP00000021661
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 3.9e-8 PFAM
Pfam:FAD_binding_3 334 435 1.3e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065536
SMART Domains Protein: ENSMUSP00000070407
Gene: ENSMUSG00000021234

DomainStartEndE-ValueType
low complexity region 57 65 N/A INTRINSIC
low complexity region 93 107 N/A INTRINSIC
Pfam:UPF0564 168 535 8.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110276
SMART Domains Protein: ENSMUSP00000105905
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 5.1e-8 PFAM
Pfam:FAD_binding_3 334 435 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110278
SMART Domains Protein: ENSMUSP00000105907
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 6.8e-8 PFAM
Pfam:FAD_binding_3 334 410 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133230
Predicted Effect probably benign
Transcript: ENSMUST00000145522
SMART Domains Protein: ENSMUSP00000117609
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d1foha5 35 167 2e-6 SMART
PDB:4K22|B 90 156 3e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150391
Predicted Effect probably benign
Transcript: ENSMUST00000152913
SMART Domains Protein: ENSMUSP00000115676
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1foha5 39 269 1e-10 SMART
PDB:4K22|B 94 274 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153450
Meta Mutation Damage Score 0.432 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Fam161b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Fam161b APN 12 84361751 unclassified probably benign
IGL00900:Fam161b APN 12 84355969 missense probably benign 0.05
IGL00905:Fam161b APN 12 84357685 missense probably benign 0.00
IGL01123:Fam161b APN 12 84357664 missense probably benign 0.00
IGL02156:Fam161b APN 12 84354753 missense probably benign 0.00
IGL02630:Fam161b APN 12 84353914 missense probably benign 0.03
IGL02670:Fam161b APN 12 84357594 missense probably benign 0.00
IGL03160:Fam161b APN 12 84353825 missense probably benign 0.05
R0560:Fam161b UTSW 12 84357718 missense probably damaging 0.96
R0569:Fam161b UTSW 12 84348639 missense probably damaging 1.00
R1834:Fam161b UTSW 12 84348778 splice site probably benign
R2070:Fam161b UTSW 12 84356428 missense probably benign 0.00
R3786:Fam161b UTSW 12 84361690 critical splice donor site probably null
R4697:Fam161b UTSW 12 84348558 unclassified probably benign
R5247:Fam161b UTSW 12 84357750 missense probably damaging 1.00
R5390:Fam161b UTSW 12 84348634 missense probably damaging 0.99
R5668:Fam161b UTSW 12 84356350 missense probably damaging 0.96
R6891:Fam161b UTSW 12 84354780 missense probably damaging 1.00
X0019:Fam161b UTSW 12 84354973 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CAGAGCCTGGTACAAGACAC -3'
(R):5'- AGAAGACGCTCTTGCCTCATTG -3'

Sequencing Primer
(F):5'- GCCTGGTACAAGACACAAAAG -3'
(R):5'- CTCATTGGGCGGAACAGAC -3'
Posted On2015-03-25