Incidental Mutation 'R3784:Nsa2'
ID272192
Institutional Source Beutler Lab
Gene Symbol Nsa2
Ensembl Gene ENSMUSG00000060739
Gene NameNSA2 ribosome biogenesis homolog
Synonyms5730427N09Rik, LNR42, Nsa2p, Yr29
MMRRC Submission 040876-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R3784 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location97129424-97137937 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97135534 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 60 (Q60K)
Ref Sequence ENSEMBL: ENSMUSP00000073161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022170] [ENSMUST00000042084] [ENSMUST00000073456] [ENSMUST00000160139] [ENSMUST00000161639] [ENSMUST00000161825] [ENSMUST00000161913] [ENSMUST00000161929] [ENSMUST00000169863] [ENSMUST00000225410]
Predicted Effect probably benign
Transcript: ENSMUST00000022170
SMART Domains Protein: ENSMUSP00000022170
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 66 349 9.9e-64 PFAM
Pfam:GTP_EFTU_D2 379 446 4.3e-8 PFAM
low complexity region 447 473 N/A INTRINSIC
Pfam:EFG_II 482 556 3.9e-29 PFAM
EFG_IV 558 677 2.94e-17 SMART
EFG_C 679 766 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042084
SMART Domains Protein: ENSMUSP00000048373
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 324 4.6e-64 PFAM
Pfam:GTP_EFTU_D2 354 421 4.2e-8 PFAM
low complexity region 422 448 N/A INTRINSIC
Pfam:EFG_II 457 531 3.7e-29 PFAM
EFG_IV 533 652 2.94e-17 SMART
EFG_C 654 741 1.9e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073456
AA Change: Q60K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073161
Gene: ENSMUSG00000060739
AA Change: Q60K

DomainStartEndE-ValueType
Pfam:Ribosomal_S8e 1 259 1.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160139
SMART Domains Protein: ENSMUSP00000124426
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 241 3.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161518
Predicted Effect probably benign
Transcript: ENSMUST00000161639
SMART Domains Protein: ENSMUSP00000125656
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 1.2e-68 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 4.5e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 768 1.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161825
SMART Domains Protein: ENSMUSP00000125088
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 2.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 1.1e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 558 7.1e-30 PFAM
EFG_IV 560 679 2.94e-17 SMART
EFG_C 681 738 3.46e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161843
Predicted Effect probably benign
Transcript: ENSMUST00000161913
SMART Domains Protein: ENSMUSP00000124253
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 351 3.3e-64 PFAM
Pfam:GTP_EFTU_D2 381 448 3.2e-8 PFAM
low complexity region 449 475 N/A INTRINSIC
Pfam:EFG_II 484 532 2.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161929
SMART Domains Protein: ENSMUSP00000125306
Gene: ENSMUSG00000021666

DomainStartEndE-ValueType
Pfam:GTP_EFTU 68 94 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169863
SMART Domains Protein: ENSMUSP00000126209
Gene: ENSMUSG00000041817

DomainStartEndE-ValueType
low complexity region 374 386 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224980
Predicted Effect possibly damaging
Transcript: ENSMUST00000225410
AA Change: Q60K

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.336 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein involved in cell cycle regulation and proliferation. This gene was identified based on sequence similarity to a highly conserved Saccharomyces cerevisiae gene encoding a pre-ribosomal protein, which is involved in large ribosomal subunit biogenesis. The encoded protein is found at elevated levels in diabetic nephropathy. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
3110082I17Rik G T 5: 139,455,442 P35Q probably damaging Het
Adam11 T C 11: 102,774,367 probably null Het
Ank2 A G 3: 126,953,193 L581P probably damaging Het
Armc2 T C 10: 41,922,194 I779V probably benign Het
Atp8a2 A T 14: 59,773,966 Y965N probably damaging Het
C3 A G 17: 57,226,067 V146A probably damaging Het
Cfap206 A T 4: 34,716,445 I340N probably damaging Het
Col3a1 A G 1: 45,347,135 D145G probably damaging Het
Drosha A G 15: 12,890,529 D954G possibly damaging Het
Fam161b A T 12: 84,361,690 probably null Het
Fat2 C T 11: 55,256,186 A3995T probably benign Het
Foxg1 A G 12: 49,385,599 T372A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Hook1 T C 4: 95,989,651 F55L probably damaging Het
Iars2 T C 1: 185,287,131 K986R probably benign Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Klra8 T A 6: 130,125,055 D139V probably benign Het
Mical3 T C 6: 121,021,337 Y20C probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Ncoa6 G A 2: 155,407,757 T1209I probably damaging Het
Olfml2b A G 1: 170,681,982 D633G probably damaging Het
Plekhg3 T C 12: 76,560,520 probably null Het
Plxna2 T A 1: 194,644,617 D286E probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Prmt7 C A 8: 106,242,136 Q361K probably benign Het
Prrc2c T C 1: 162,709,669 probably benign Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rad51b C T 12: 79,300,645 Q28* probably null Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Spats2l A G 1: 57,885,779 E112G probably damaging Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Taf15 G A 11: 83,506,422 D313N unknown Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Tubb6 A G 18: 67,392,993 T72A possibly damaging Het
Txndc16 A T 14: 45,165,886 V32E probably damaging Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Other mutations in Nsa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Nsa2 APN 13 97132017 missense probably damaging 1.00
R3783:Nsa2 UTSW 13 97135534 missense possibly damaging 0.93
R3786:Nsa2 UTSW 13 97135534 missense possibly damaging 0.93
R3787:Nsa2 UTSW 13 97135534 missense possibly damaging 0.93
R3878:Nsa2 UTSW 13 97132034 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCAGCAGATAGGCAGGGAC -3'
(R):5'- GTGTAAGCACATGAATACTGTCC -3'

Sequencing Primer
(F):5'- GGTTCAGAATGTGCACAG -3'
(R):5'- CGACCACCTGTAATGAGATCTGATG -3'
Posted On2015-03-25