Mutagenetix > Incidental Mutations

Incidental Mutation 'R3784:Atp8a2'

272194

Institutional Source

Beutler Lab

Gene Symbol

Atp8a2

Ensembl Gene

ENSMUSG00000021983

Gene Name

ATPase, aminophospholipid transporter-like, class I, type 8A, member 2

Synonyms

wl, Ib

MMRRC Submission

040876-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.674) question?

Stock #

R3784 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59638540-60197179 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59773966 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 965 (Y965N)

Ref Sequence

ENSEMBL: ENSMUSP00000079238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080368]

Predicted Effect

probably damaging
Transcript: ENSMUST00000080368
AA Change: Y965N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: Y965N

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	14	80	2.3e-27	PFAM
Pfam:E1-E2_ATPase	85	348	6.7e-15	PFAM
Pfam:HAD	385	790	3.2e-22	PFAM
Pfam:Cation_ATPase	465	564	3.2e-14	PFAM
Pfam:PhoLip_ATPase_C	807	1059	2.8e-79	PFAM

Meta Mutation Damage Score

0.486

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
3110082I17Rik	G	T	5: 139,455,442	P35Q	probably damaging	Het
Adam11	T	C	11: 102,774,367		probably null	Het
Ank2	A	G	3: 126,953,193	L581P	probably damaging	Het
Armc2	T	C	10: 41,922,194	I779V	probably benign	Het
C3	A	G	17: 57,226,067	V146A	probably damaging	Het
Cfap206	A	T	4: 34,716,445	I340N	probably damaging	Het
Col3a1	A	G	1: 45,347,135	D145G	probably damaging	Het
Drosha	A	G	15: 12,890,529	D954G	possibly damaging	Het
Fam161b	A	T	12: 84,361,690		probably null	Het
Fat2	C	T	11: 55,256,186	A3995T	probably benign	Het
Foxg1	A	G	12: 49,385,599	T372A	probably benign	Het
Heatr1	G	T	13: 12,434,460	L1946F	probably damaging	Het
Hook1	T	C	4: 95,989,651	F55L	probably damaging	Het
Iars2	T	C	1: 185,287,131	K986R	probably benign	Het
Inpp5k	T	C	11: 75,647,686	L461P	probably damaging	Het
Klra8	T	A	6: 130,125,055	D139V	probably benign	Het
Mical3	T	C	6: 121,021,337	Y20C	probably benign	Het
Myo15	A	T	11: 60,477,572	Y386F	probably damaging	Het
Ncoa6	G	A	2: 155,407,757	T1209I	probably damaging	Het
Nsa2	G	T	13: 97,135,534	Q60K	possibly damaging	Het
Olfml2b	A	G	1: 170,681,982	D633G	probably damaging	Het
Plekhg3	T	C	12: 76,560,520		probably null	Het
Plxna2	T	A	1: 194,644,617	D286E	probably benign	Het
Pmepa1	G	A	2: 173,228,133	R210W	probably damaging	Het
Prmt7	C	A	8: 106,242,136	Q361K	probably benign	Het
Prrc2c	T	C	1: 162,709,669		probably benign	Het
Psg27	T	A	7: 18,560,354	Q376L	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rad51b	C	T	12: 79,300,645	Q28*	probably null	Het
Rala	T	A	13: 17,882,446	E185V	probably benign	Het
Sall4	A	G	2: 168,756,123	S266P	probably damaging	Het
Senp6	T	G	9: 80,092,286	I74S	probably benign	Het
Spats2l	A	G	1: 57,885,779	E112G	probably damaging	Het
Synrg	T	C	11: 84,001,920	F613S	probably damaging	Het
Taf15	G	A	11: 83,506,422	D313N	unknown	Het
Tekt1	A	G	11: 72,344,894	I376T	probably damaging	Het
Thbs4	T	C	13: 92,773,164	N375S	probably benign	Het
Tubb6	A	G	18: 67,392,993	T72A	possibly damaging	Het
Txndc16	A	T	14: 45,165,886	V32E	probably damaging	Het
Vmn1r200	A	T	13: 22,395,855	Y276F	possibly damaging	Het

Other mutations in Atp8a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01289:Atp8a2	APN	14	59691461	missense	probably benign	0.00
IGL01505:Atp8a2	APN	14	60028063	missense	probably benign	0.00
IGL01614:Atp8a2	APN	14	60044988	missense	probably damaging	0.99
IGL01621:Atp8a2	APN	14	60015868	splice site	probably benign
IGL01634:Atp8a2	APN	14	59998062	missense	probably benign	0.01
IGL01672:Atp8a2	APN	14	59691533	missense	probably benign	0.01
IGL01898:Atp8a2	APN	14	60023513	missense	probably damaging	1.00
IGL01945:Atp8a2	APN	14	60026160	missense	probably damaging	1.00
IGL02006:Atp8a2	APN	14	59857048	missense	possibly damaging	0.90
IGL02089:Atp8a2	APN	14	60026920	splice site	probably null
IGL02211:Atp8a2	APN	14	60027976	missense	probably benign	0.00
IGL02283:Atp8a2	APN	14	60016799	missense	possibly damaging	0.86
IGL02337:Atp8a2	APN	14	59998002	missense	probably benign	0.32
IGL02571:Atp8a2	APN	14	60012458	splice site	probably benign
IGL02795:Atp8a2	APN	14	60033742	missense	probably damaging	0.96
IGL02874:Atp8a2	APN	14	59802252	missense	probably damaging	1.00
IGL02999:Atp8a2	APN	14	59925122	nonsense	probably null
IGL03307:Atp8a2	APN	14	60015872	critical splice donor site	probably null
IGL03345:Atp8a2	APN	14	59774011	missense	probably benign
R0334:Atp8a2	UTSW	14	59691512	missense	probably damaging	1.00
R0368:Atp8a2	UTSW	14	59860212	missense	probably damaging	1.00
R0420:Atp8a2	UTSW	14	59773744	missense	probably damaging	1.00
R0684:Atp8a2	UTSW	14	60023144	missense	probably benign	0.00
R0755:Atp8a2	UTSW	14	60009881	missense	possibly damaging	0.96
R0853:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0908:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R0991:Atp8a2	UTSW	14	59793929	missense	probably benign	0.33
R1025:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1190:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1387:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1426:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1442:Atp8a2	UTSW	14	59860323	splice site	probably benign
R1472:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1538:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1573:Atp8a2	UTSW	14	59860206	missense	probably benign	0.00
R1620:Atp8a2	UTSW	14	59791183	missense	probably benign
R1661:Atp8a2	UTSW	14	59860186	missense	possibly damaging	0.80
R1673:Atp8a2	UTSW	14	59791240	missense	probably benign	0.00
R1749:Atp8a2	UTSW	14	59860174	nonsense	probably null
R1796:Atp8a2	UTSW	14	60020758	critical splice donor site	probably null
R1815:Atp8a2	UTSW	14	60086624	missense	probably damaging	1.00
R1836:Atp8a2	UTSW	14	60006366	missense	possibly damaging	0.49
R1935:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1936:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R1937:Atp8a2	UTSW	14	59860270	missense	probably benign	0.01
R2416:Atp8a2	UTSW	14	59925008	missense	probably damaging	1.00
R2760:Atp8a2	UTSW	14	59860192	missense	probably benign	0.43
R3029:Atp8a2	UTSW	14	59691465	frame shift	probably null
R3621:Atp8a2	UTSW	14	60026138	splice site	probably null
R3768:Atp8a2	UTSW	14	60044336	missense	probably benign	0.19
R3896:Atp8a2	UTSW	14	60026140	critical splice donor site	probably null
R4009:Atp8a2	UTSW	14	60027985	missense	possibly damaging	0.54
R4591:Atp8a2	UTSW	14	59654629	missense	probably benign	0.03
R4866:Atp8a2	UTSW	14	59691467	missense	probably damaging	1.00
R4879:Atp8a2	UTSW	14	60008469	nonsense	probably null
R5059:Atp8a2	UTSW	14	59691537	missense	probably benign	0.00
R5529:Atp8a2	UTSW	14	59793865	critical splice donor site	probably null
R5788:Atp8a2	UTSW	14	60020793	missense	probably damaging	0.96
R6126:Atp8a2	UTSW	14	60044326	missense	probably benign
R6295:Atp8a2	UTSW	14	60012399	nonsense	probably null
R6393:Atp8a2	UTSW	14	59773755	nonsense	probably null
R6454:Atp8a2	UTSW	14	60008499	splice site	probably null
R6651:Atp8a2	UTSW	14	59774021	missense	probably benign	0.00
R6763:Atp8a2	UTSW	14	60008408	missense	probably benign	0.12
R6767:Atp8a2	UTSW	14	60046722	missense	probably damaging	1.00
R6912:Atp8a2	UTSW	14	60012410	missense	probably benign	0.33
Z1088:Atp8a2	UTSW	14	60027970	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCTGTCGTCTCCAAACCAG -3'
(R):5'- GCTTGTTTTCCAGCCAGAC -3'

Sequencing Primer
(F):5'- ACTGTAACCACAACGTACTGTG -3'
(R):5'- GCTTGTTTTCCAGCCAGACAAAAAG -3'

Posted On

2015-03-25