Incidental Mutation 'R3785:Olfr1012'
ID272202
Institutional Source Beutler Lab
Gene Symbol Olfr1012
Ensembl Gene ENSMUSG00000075210
Gene Nameolfactory receptor 1012
SynonymsGA_x6K02T2Q125-47239120-47238185, MOR213-6
MMRRC Submission 040752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.045) question?
Stock #R3785 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85757353-85762766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85759453 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 308 (P308S)
Ref Sequence ENSEMBL: ENSMUSP00000148952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099916] [ENSMUST00000214255] [ENSMUST00000214958] [ENSMUST00000216831]
Predicted Effect probably benign
Transcript: ENSMUST00000099916
AA Change: P308S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097500
Gene: ENSMUSG00000075210
AA Change: P308S

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 1.7e-47 PFAM
Pfam:7tm_1 40 289 8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214255
AA Change: P308S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000214958
AA Change: P308S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216831
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
A2ml1 C T 6: 128,544,924 probably null Het
Aak1 T C 6: 86,965,578 F701S unknown Het
Arid2 T A 15: 96,372,558 D1517E possibly damaging Het
Cyp2r1 C T 7: 114,554,696 V88I possibly damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dnah11 G T 12: 118,017,602 Q2610K probably damaging Het
Gm5698 T C 1: 30,977,479 T164A probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Gpx6 A G 13: 21,313,786 T76A probably benign Het
Htra3 A T 5: 35,671,128 L136H probably benign Het
Ifitm10 G A 7: 142,328,598 T145I possibly damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Kcnd3 C A 3: 105,668,225 T555K possibly damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Mcf2l G T 8: 12,880,099 G40C probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Mus81 G A 19: 5,485,361 probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Mypn C A 10: 63,193,182 R34L probably benign Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Olfr1305 T C 2: 111,873,486 Y123C probably damaging Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf5 A G 17: 34,601,932 probably null Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Slc13a4 T A 6: 35,287,892 T131S probably damaging Het
Slc9a4 C A 1: 40,583,970 P123Q probably damaging Het
Stxbp4 T A 11: 90,535,615 probably null Het
Swt1 T C 1: 151,379,404 D814G probably benign Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Wap G A 11: 6,638,550 Q25* probably null Het
Zfp26 A T 9: 20,437,802 C489S probably damaging Het
Zfp804b G A 5: 6,770,153 T934M possibly damaging Het
Other mutations in Olfr1012
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01799:Olfr1012 APN 2 85759642 missense probably benign 0.30
IGL02334:Olfr1012 APN 2 85760159 nonsense probably null
IGL03050:Olfr1012 UTSW 2 85759441 makesense probably null
R0399:Olfr1012 UTSW 2 85759904 missense possibly damaging 0.53
R1730:Olfr1012 UTSW 2 85760242 missense possibly damaging 0.91
R2142:Olfr1012 UTSW 2 85759677 missense probably benign 0.07
R2185:Olfr1012 UTSW 2 85760019 missense probably damaging 1.00
R2412:Olfr1012 UTSW 2 85759680 missense probably damaging 0.99
R3552:Olfr1012 UTSW 2 85759893 missense possibly damaging 0.46
R4096:Olfr1012 UTSW 2 85759696 missense possibly damaging 0.55
R4097:Olfr1012 UTSW 2 85759696 missense possibly damaging 0.55
R5199:Olfr1012 UTSW 2 85760214 missense probably damaging 1.00
R5206:Olfr1012 UTSW 2 85759623 missense probably benign 0.31
R5444:Olfr1012 UTSW 2 85759919 missense probably benign 0.39
R5567:Olfr1012 UTSW 2 85759650 missense probably damaging 1.00
R5570:Olfr1012 UTSW 2 85759650 missense probably damaging 1.00
R5956:Olfr1012 UTSW 2 85753839 unclassified probably benign
R6406:Olfr1012 UTSW 2 85760307 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCCTGTCATAATTCCACATGATG -3'
(R):5'- GTGACCTTGTACTATGGCTCCATTC -3'

Sequencing Primer
(F):5'- TGTCCTATTTCACACTCAATACAAAC -3'
(R):5'- CTCTACATCTACTCTCGGCCAAG -3'
Posted On2015-03-25