Incidental Mutation 'R3785:Mypn'
ID272220
Institutional Source Beutler Lab
Gene Symbol Mypn
Ensembl Gene ENSMUSG00000020067
Gene Namemyopalladin
Synonyms1110056A04Rik
MMRRC Submission 040752-MU
Accession Numbers

Genbank: NM_182992; MGI: 1916052

Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R3785 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63115795-63203952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63193182 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 34 (R34L)
Ref Sequence ENSEMBL: ENSMUSP00000093240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095580]
Predicted Effect probably benign
Transcript: ENSMUST00000095580
AA Change: R34L

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093240
Gene: ENSMUSG00000020067
AA Change: R34L

DomainStartEndE-ValueType
low complexity region 46 56 N/A INTRINSIC
low complexity region 225 245 N/A INTRINSIC
IGc2 279 346 2.16e-8 SMART
low complexity region 384 405 N/A INTRINSIC
IGc2 444 519 1.69e-10 SMART
low complexity region 636 648 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 721 741 N/A INTRINSIC
low complexity region 779 794 N/A INTRINSIC
low complexity region 826 838 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
IGc2 953 1022 1.64e-8 SMART
IGc2 1080 1148 3.67e-11 SMART
IG 1173 1259 1.17e-4 SMART
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Striated muscle in vertebrates comprises large proteins which must be organized properly to contract efficiently. Z-lines in striated muscle are a sign of this organization, representing the ends of actin thin filaments, titin, nebulin or nebulette and accessory proteins required for structure and function. This gene encodes a protein which interacts with nebulin in skeletal muscle or nebulette in cardiac muscle and alpha-actinin. In addition, this gene product can interact with a protein with the I-band indicating it has a regulatory as well as structural function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(51) : Gene trapped(51)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
A2ml1 C T 6: 128,544,924 probably null Het
Aak1 T C 6: 86,965,578 F701S unknown Het
Arid2 T A 15: 96,372,558 D1517E possibly damaging Het
Cyp2r1 C T 7: 114,554,696 V88I possibly damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dnah11 G T 12: 118,017,602 Q2610K probably damaging Het
Gm5698 T C 1: 30,977,479 T164A probably benign Het
Gpt2 G T 8: 85,525,573 V506L probably benign Het
Gpx6 A G 13: 21,313,786 T76A probably benign Het
Htra3 A T 5: 35,671,128 L136H probably benign Het
Ifitm10 G A 7: 142,328,598 T145I possibly damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Kcnd3 C A 3: 105,668,225 T555K possibly damaging Het
Kif13b C T 14: 64,800,400 T1505I probably benign Het
Mcf2l G T 8: 12,880,099 G40C probably damaging Het
Mettl3 A T 14: 52,299,906 I102N probably benign Het
Muc5b C T 7: 141,865,116 T3933I possibly damaging Het
Mus81 G A 19: 5,485,361 probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Olfr1012 G A 2: 85,759,453 P308S probably benign Het
Olfr1305 T C 2: 111,873,486 Y123C probably damaging Het
Olfr951 T C 9: 39,394,382 V197A probably benign Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf5 A G 17: 34,601,932 probably null Het
Sacs C A 14: 61,183,961 Q116K probably damaging Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Senp6 T G 9: 80,092,286 I74S probably benign Het
Slc13a4 T A 6: 35,287,892 T131S probably damaging Het
Slc9a4 C A 1: 40,583,970 P123Q probably damaging Het
Stxbp4 T A 11: 90,535,615 probably null Het
Swt1 T C 1: 151,379,404 D814G probably benign Het
Synrg T C 11: 84,001,920 F613S probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Txnl4b C T 8: 109,572,777 A123V probably damaging Het
Wap G A 11: 6,638,550 Q25* probably null Het
Zfp26 A T 9: 20,437,802 C489S probably damaging Het
Zfp804b G A 5: 6,770,153 T934M possibly damaging Het
Other mutations in Mypn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mypn APN 10 63192423 missense probably damaging 1.00
IGL01137:Mypn APN 10 63152854 missense probably benign 0.12
IGL01383:Mypn APN 10 63135797 missense probably damaging 1.00
IGL01560:Mypn APN 10 63134964 missense probably benign 0.27
IGL01569:Mypn APN 10 63127759 missense probably damaging 1.00
IGL02197:Mypn APN 10 63123278 missense possibly damaging 0.69
IGL02829:Mypn APN 10 63192586 missense probably benign 0.01
IGL03221:Mypn APN 10 63131123 missense probably damaging 1.00
IGL03377:Mypn APN 10 63192865 missense probably benign 0.01
2107:Mypn UTSW 10 63203751 utr 5 prime probably benign
PIT4576001:Mypn UTSW 10 63120071 missense probably damaging 1.00
R0115:Mypn UTSW 10 63192380 splice site probably benign
R0377:Mypn UTSW 10 63127622 unclassified probably benign
R0480:Mypn UTSW 10 63193203 missense probably benign 0.01
R0581:Mypn UTSW 10 63162244 missense probably benign 0.06
R0669:Mypn UTSW 10 63134923 splice site probably benign
R0822:Mypn UTSW 10 63169256 missense probably damaging 1.00
R1209:Mypn UTSW 10 63118499 missense probably damaging 1.00
R1401:Mypn UTSW 10 63152857 missense probably damaging 0.96
R1513:Mypn UTSW 10 63169368 missense probably damaging 0.99
R1750:Mypn UTSW 10 63136197 missense probably benign 0.01
R1780:Mypn UTSW 10 63121964 missense probably damaging 1.00
R1791:Mypn UTSW 10 63125693 missense probably damaging 0.97
R1859:Mypn UTSW 10 63146190 missense probably benign
R1903:Mypn UTSW 10 63123397 missense probably benign 0.06
R2275:Mypn UTSW 10 63131069 missense probably damaging 1.00
R2420:Mypn UTSW 10 63192869 nonsense probably null
R3425:Mypn UTSW 10 63118417 splice site probably benign
R3767:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3768:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3770:Mypn UTSW 10 63125707 missense possibly damaging 0.88
R3777:Mypn UTSW 10 63147982 missense possibly damaging 0.92
R3888:Mypn UTSW 10 63192510 missense probably damaging 1.00
R4289:Mypn UTSW 10 63131182 missense probably damaging 1.00
R4301:Mypn UTSW 10 63118484 missense probably damaging 1.00
R4366:Mypn UTSW 10 63192708 missense probably benign 0.00
R4459:Mypn UTSW 10 63192432 missense probably damaging 1.00
R4921:Mypn UTSW 10 63147936 missense possibly damaging 0.75
R4995:Mypn UTSW 10 63119968 intron probably null
R5064:Mypn UTSW 10 63123371 missense possibly damaging 0.68
R5083:Mypn UTSW 10 63118528 missense probably damaging 0.98
R5108:Mypn UTSW 10 63136294 missense probably damaging 1.00
R5399:Mypn UTSW 10 63120186 missense probably benign 0.03
R5438:Mypn UTSW 10 63135839 nonsense probably null
R5590:Mypn UTSW 10 63120048 missense probably benign 0.27
R5652:Mypn UTSW 10 63135801 missense probably damaging 1.00
R5717:Mypn UTSW 10 63127776 missense probably damaging 1.00
R5970:Mypn UTSW 10 63131023 missense probably benign 0.36
R6616:Mypn UTSW 10 63169312 missense probably damaging 1.00
R6930:Mypn UTSW 10 63116939 missense probably damaging 1.00
R6987:Mypn UTSW 10 63193131 missense probably benign 0.00
R7020:Mypn UTSW 10 63192510 missense probably damaging 1.00
R7081:Mypn UTSW 10 63134958 missense probably damaging 1.00
R7477:Mypn UTSW 10 63125721 missense possibly damaging 0.89
X0022:Mypn UTSW 10 63136063 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTTCGTCTGGTCGGAAG -3'
(R):5'- AGTCTCTGTGCTGAAGTAAAGGC -3'

Sequencing Primer
(F):5'- TCGGAAGACAGACGCTTCCTG -3'
(R):5'- GAAGTAAAGGCAGGCTTGTTATTCC -3'
Posted On2015-03-25